Q: Contrast gene paralogs with gene orthologs.
A: The functional and structural unit of inheritance is a gene. These are composed of DNA. There are…
Q: Design an experiment to determine whether a specific gene is transcribed by RNA polymerase II.
A: RNA polymerase II (Pol II) is responsible for the flow of genetic information from DNA to messenger…
Q: Two examples utilize RNA reverse transcription in their biology, what are they?
A: Reverse transcription is the exact opposite of the transcription. It involves the synthesis of the…
Q: explain how splicing can allow the same gene to encode different proteins of different lengths.
A:
Q: Describe the function of a reporter gene.
A: Gene is the primary fundamental unit. These are made up of Deoxyribonucleic acid (DNA). These are a…
Q: Give examples of structural motifs found in transcription factors that interact with other proteins…
A: Transcription is an important step in the use of genes to produce a protein. Proteins that help bind…
Q: Which are the three types of RNA polymerases transcribe genes in Kukaryotes?
A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…
Q: How far apart are transcription bubbles on E. coli genes that are being transcribed at a maximal…
A: The transcription bubble is an area of unpaired bases on one of the uncovered DNA strands. The…
Q: Provide the complementary strand and the RNA transcription product for the following DNA template…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…
A: In Sanger sequencing, the objective is to analyze the sequence of a given strand of DNA. To obtain…
Q: What is the name of the region on the chromosome that signals the RNA-coding region is about to…
A: 'The DNA material in chromosomes is composed of "coding" and "non-coding" regions. The coding…
Q: Briefly describe the experiment that demonstrates that the transposition of the Ty1 element in yeast…
A: Ty1 is a retrotransposon which is transpose via RNA intermediate, and this type of element found in…
Q: a.) Which of the following molecules would you need to mutate a gene with non-homologous chromosomal…
A: Gene expression is defined as the process by which genetic data encoded inside a gene is used to…
Q: What are single-stranded RNA fragments that associate with a protein complex to induce gene…
A: RNA interference, also termed as RNA silencing, is a biological reaction to double-stranded RNA that…
Q: What is the significance of the fact that human mRNA can be accurately translated in E. coli ?
A: For translation the eukaryotic system and prokaryotic system both are different.
Q: Identify the promoter in the diagram shown below. 1 2 3 4 7 8 4 6. 7 1 00
A: The promoter serves as a binding site for RNA polymerase, the transcription enzyme. The lac…
Q: Discuss the genetic switch that controls the lytic versus lysogenic path in bacteriophage lambda.
A: Gene regulatory network that shows bistable behavior is known as genetic switches. It is studied…
Q: explain RNA editing in trypanosomes
A: RNA editing are mechanism that are responsible in producing functional mRNA , so that conventional…
Q: Describe the process of transcription in eukaryotes from the time the RNA polymerase binds to the…
A: The process of transcription in eukaryotes occurs in the nucleus of the cells and it includes the…
Q: There are 3 RNA polymerases in eukaryotes. Write a sentence about the function of each. Which is…
A: RNA polymerase enzyme synthesizes RNA from template of DNA.
Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: Write notes on two of the following -Inducible system of gene regulation - Eukaryotic DNA polymerase…
A: Gene regulation refers to turning genes on or off. Genes are necessary information the cell needs in…
Q: Describe how RNA primers are removed in eukaryotes.
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: Explain the following term: Gene:
A: Genes are found on chromosomes, which are small spaghetti-like structures.
Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…
A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…
Q: RNA polymerase must detect and transcribe discrete genes from within large stretches of DNA. What…
A: Transcription is the process where a messenger RNA (mRNA) is made from the segment of DNA by the use…
Q: What is the difference between a paralog and an ortholog?
A: Phylogeny: It is the study of relationships among different organisms and their evolutionary…
Q: Please describe the synthesis and processing of rRNA.
A: Ribosomal RNA (rRNA) It is a structural molecule that generates half of the ribosome and involved in…
Q: In the fX174 genome, describe the difference between how thegene B and gene A* proteins are made
A: fX174:- Craig venter and his group reported the genome of fX174 in in-vitro conditions. It is a…
Q: Which of the following are true for the c-myc gene? Select all that apply
A: Myc is a group of regulator genes that code for transcription factors. c-myc is one of the genes in…
Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)
A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…
Q: When a gene is being transcribed, the nitrogenous base code must be made available for reading by…
A:
Q: Write a short description about post transcriptional modification?
A: DNA transcription happens in the nucleus of the cells. The RNA that is produced in this process is…
Q: Which eukaryotic RNA polymerase (RNA pol I,pol II, or pol III) transcribes which genes?a. tRNAsb.…
A: RNA polymerase is an enzyme that synthesizes RNA from a DNA template. Different RNA polymerases…
Q: This chapter describes different types of TEs, including insertionelements, simple transposons, LTR…
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: Consider two genes that are next to each other on a chromosome, as arranged in the figure P0509 jpg…
A: The production of RNA from the DNA is known as transcription or gene expression that occurs within…
Q: Describe how the genome of bacteriophage fX174 istranscribed and translated.
A: Bacteriophages are special type of virus that can infect a bacterial species.
Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: Write a note on post translational modifications. Draw a diagram as well.
A: Post-translational change alludes to the covalent and by and large enzymatic adjustment of proteins…
Q: Following replication of the viral RNA, the mRNA coding for the Spike protein is produced. The part…
A: Codon is the sequence that is made of 3 consecutive amino acids that code for a specific amino acid.…
Q: a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b.…
A: The process of synthesis of mRNA from DNA is called transcription. This process takes place with the…
Q: Draw a typical bacterial protein-coding gene; label the important portions of the gene and the…
A: Answer:Introduction: Gene duplication is considered to be the general method to make new genes, but…
Q: Write a paragraph describing the abbreviated chemical reactions that summarize RNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Briefly state the function of each of the lettered sites on the outlined gene below. +1 ТАТА Coding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical / ladder like structure which act as genetic…
Q: From what DNA template strand was each of the following hnRNA base sequences transcribed?
A: hn RNA (heterogenous RNA ) in eukaryote transcribed from the DNA and it complementary of DNA…
Q: how does the sequence of the primary transcript resemble the sequence of the gene encoding it
A: The genes undergo transcription to form mRNA. The mRNA is then modified via post-transcriptional…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. αGenetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailBONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
- Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
- identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)
- Create a metabolism cocept map using these terms RepressorInducer RiboswitchRepression InductionPositive regulationActivatorOperator Heat shocklac operontrp operon Catabolite RepressionHeat shocksigma-32 Negative regulationTwo-component regulationSensor Kinase Autoinducing Peptide (AIP)Response regulatorSigma factorsFeedback inhibitionProtein StabilityQuorum SensingRNA regulationAntisense RNAHomoserine Lactone (AHL)Finish the translation story: - fully explain the G factor stories for each step – and the antibioticthat inhibits it.o how is the next aa brought into the A site of the ribosome and how is it chosen to be thecorrect one. How does streptomycin impact this?o How does the ribosome connect the growing chain of aa to the next one in the A site?How does chloramphenicol impact this?o How does the ribosome step to the next codon? How does spectinomycin impact this?point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 L