• Whether a mutation is recessive or dominant to wild typedepends on how drastically the protein product is alteredand how sensitive ________ is to the abnormal genefunction.?

Wild type genomic sequence of a portion of a gene and the wild type sequence of portion of the protein gene product. The protein sequence only matches partially. ТАT AAA GGG СGA ССА ССТ GсT AАT GGG АСт тTG AGG Tyr Lys Gly Arg Pro Pro Ala Pro Arg Gln Tyr Trp Note: The five amino acids at the amino end of the WT protein match the coding sequence perfectly, but not the six at the carboxyl end. This is for an obvious reason that you should figure out before starting the problem. One of the difficulties with this problem is that you do not have the DNA sequence for the carboxyl end of the protein, but that should not be a problem! And, so far, there are no mutations; nothing unusual, it is just a normal eukaryotic gene!! A mutant is found that has the following protein sequence in that part of the protein: Tyr Lys Gly Arg Thr Cys Ser Premature Stop. What is the likely mutation? between A12 and C13 insert T. between C13 and C14 insert T. A15 -> del. C13 and C14 -> del. G8 -> T. G20 -> A. T21…

Mutations outside the coding sequences can modify geneexpression by altering the amount, time, or place of__________ production.?

Dynamic mutations are associated with what type of diseases?   Genomic imprinting diseases Trinucleotide repeat disease Maternal effect diseases Mitochondrial diseases None of the answers are correct

Briefly explain how Genome Wide Association Studies (GWAS) are done. Then, using this example of a Manhattan Plot explain what each of the X-axis and the Y-axis signifies in a GWAS.

My question:

Fill in the blank. [x]  _________  genes are pairs of genes within an organism’s genome that have diverged from duplication events.

I sequence the DNA of 3 people and see variation in my gene of interest as follows:   Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT   What is the name for this kind of variation?