
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Fill the blank
Combinatorial strategies at the DNA level and RNA level,
as well as __________ modifications of proteins,
allow the production of highly diversified gene products
even from a single gene
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…arrow_forwardConsider the retinoblastoma gene, which is 7,500bp long. If RNA polymerase can transcribe at the rate of 50 nucleotides/sec, how many retinoblastoma transcripts are produced in 10 minutes?arrow_forwardNucleosomes can be assembled onto defined DNA segments. When a particular 225-bp segment of human DNA was used to assemble nucleosomes and then incubated with micrococcal nuclease, which digests DNA that is not located within the nucleosome, uniform fragments 147 bp in length were generated. Subsequent digestion of these fragments with a restriction enzyme that cuts once within the original 225-bp sequence produced two well-defined bands at 37 bp and 110 bp. Why do you suppose two well-defined fragments were generated by restriction digestion, rather than a range of fragments of different sizes? How would you interpret this result?arrow_forward
- There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…arrow_forwardWhich of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.arrow_forwardExplain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education