Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 + 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? inserted into the vector cut with BamH1 and Sma 1 O 3 O 4 O1 2

Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 + 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? inserted into the vector cut with BamH1 and Sma 1 O 3 O 4 O1 2

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.
11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx