when a cell to divide, its DNA must be replicated (copied). a.List the most important participating components and their functions in replication b.why is it important that the replication goes right and that relatively few mutations occur during the replication? c.Will the offspring of the individual who received a mutation inherit the mutation

when a cell to divide, its DNA must be replicated (copied). a.List the most important participating components and their functions in replication b.why is it important that the replication goes right and that relatively few mutations occur during the replication? c.Will the offspring of the individual who received a mutation inherit the mutation

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 11SA: The phrase 5to3 refers to the _________ . a. timing of DNA replication b. directionality of DNA...

See similar textbooks

Similar questions

During DNA replication: A. The two DNA strands separate, each strand then becomes a template for the assembly of a complementary strand. Each new DNA helix has one old strand with one new strand. B. The two DNA strands separate, each strand then becomes a template for the assembly of a similar strand. Each new DNA helix has one old strand with one new strand. C. The two DNA strands separate, each strand then becomes a template for the assembly of a similar strand. Each new DNA helix has two new strands. D. The two DNA strands separate, each strand then becomes a template for the assembly of an identical strand. Each new DNA helix has one old strand with one new strand.
Consider a DNA molecule with the following structure a. if during replication , the T at position 4 is read as an A resulting in a misincorporation in the new DNA strand . If the misincorporation is not repair , draw or write the results of the second round of replication b. After the second round of replication , what specific type of point mutation is now permanent in the DNA sequence ? c. List the two cellular mechanisms that failed to prevent the establishment of this permanent mutation .
Determine whether each statement isTRUE or FALSE.a. In eukaryotic chromosomes, DNA replication begins at a single point in the chromosome and proceeds in two directions.b. The bonds between the sugars and phosphates are broken during DNA replication.c. The elongation of the leading strand during DNA synthesis progresses away from the replication fork.d. Each DNA molecule resulting from replication has one original strand and one new strand.e. The difference in how the leading and lagging strands of DNA molecules are synthesized is due to DNA polymerase adding new nucleotides only to the 3’ end of a growing strand, and the strands are anti-parallel.
DNA replication involves a series of steps, including initiation, making primers, extension, and connecting DNA fragments. The cell uses different enzymes in a particular order to accomplish these steps. Which of the following represents the correct general order of enzyme use? A. DNA polymerases, helicase, primase, ligase B. Helicase, ligase, primase, DNA polymerases C. Helicase, primase, DNA polymerases, ligase D. Primase, helicase, DNA polymerases, ligase
What is the difference between the leading strand and the lagging strand in DNA replication? a There are different DNA polymerases involved in elongation of the leading strand and the lagging strand. b The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction. c The leading strand requires an RNA primer, whereas the lagging strand does not. d The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.
During the process of Initiation in DNA Replication, if one of the initiator proteins is not present, give specific details on what will happen.
Please explain one type of “DNA repair” mechanism (what is it, when is it used, how does it work).
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
List six types of DNA repair. Explain the basic features of each.
You see that a piece of DNA is being copied. But you cannot tell if this an example of DNA replication or RNA transcription. Describe three ways that you can tell the two processes apart.
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?