When a cell is to divide, its DNA must be replicated (copied). a) Indicate the main participating components and their functions. b) Why is it important that the replication goes right and that relatively few mutations occur during the replication?

Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…

Q: Translation is the process of ____ and occurs in the ____. a) mRNA assembly, nucleus b) amino acid…

A: DNA encodes RNA, which regulates protein synthesis. Proteins are responsible for the biochemical…

Q: In which direction does replication go?

A: DNA replication is  a semi-conservative type of replication where the two strands of DNA act as a…

Q: 4) The p53 protein normally involves a) DNA repair b) Cell cycle arrest c) Apoptosis d) All of the…

A: p53 is a gene that codes for a protein P53.

Q: Q: It has been found that some compounds, such as fungal toxins and some antibiotics, can inhibit…

A: Gene expression at the flow of information from DNA to RNA and then to proteins.

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: Answer the following questions. A) Write the protein that catalyzes the formation of phosphodiester…

A: Thousands of different enzymes catalyze metabolic processes in cells. Enzymes are proteins that…

Q: The pro Tien responsible for the initial step in unwinding the DNA helix during replication of the…

A: Answer is dnaA. The protein responsible for the initial step in unwinding the dna helix during…

Q: As a certain cell went through S phase, many mistakes were made during DNA replication that could…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Which one explains the form of genetic material before nuclear division? a) Euchromatin b)…

A: Nucleus is the control center of the cell. It is a large organelle consisting of nuclear envelope,…

Q: A cytosine is deaminated, forming uracil. Which DNA repair systems is best able to correct this…

A: The objective of the question is to identify the DNA repair system that is best suited to correct…

Q: Some cells, like nerve cells, exit G1 to enter quiescent stage called a) G₁ O b) S O c) Ga d) G₂…

A: Cell division is a phenomenon in which parent cell splits and give rise to novel cells.  Number of…

Q: The technique of DNA sequencing involves performing _______________ . A) northern blotting B)…

A: DNA sequence can be determined by performing DNA sequencing method in vitro.

Q: Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: differentiate between replication fork and replication bubble?

A: DNA replication is the process by which a single DNA molecule will produce two identical copies of…

Q: Which of the following solves the problem of shortening of chromosomes in each cell cycle?a) DNA…

A: The DNA replication mechanism is a semiconservative replication in which the parent DNA acts as the…

Q: Which of the following correctly describes the order in which cell components function during…

A: Introduction: The process through which cells produce proteins, the necessary macromolecules that…

Q: In some eukaryote organisms, myocytes are a type of stem cell that become Muscle cells. These cells…

A: The cell is the smallest, basic functional unit of life that is capable of independent existence.…

Q: What is the correct order of the stages of DNA synthesis? A) Unwinding the DNA, synthesis of a…

A: The manufacture of deoxyribonucleic acid (DNA) molecules, whether natural or artificial, is known as…

Q: Why is replication important?

A: REPLICATION - it the process of forming copy.

Q: The replicated chromosomes are separated by spindle fibres during a)  anaphase. b)  telophase.…

A: Cell cycle It is the event that makes new cells, by cell division, through six processes. They are:…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: A cell is produced with a mutation that causes it produce a completely defective TFIIH. What does…

A: Transcription is the starting point for making proteins using cells. This is where DNA is copied and…

Q: Define replication unit or replicon

A: DNA replication is the mechanism by which two similar DNA molecules are copied into a double…

Q: Which of the following involves remarkable capacity of short segment of DNA to move from one place…

A: in order to find out the correct answer, let's analyse each option 1. transposition: DNA transposons…

Q: Contrast DNA replication in eukaryotes and prokaryotes.

A: In the central dogma,  the Ribonucleic acid (RNA) is formed from the template of Deoxyribonucleic…

Q: Describe the semi-conservative nature of DNA replication.

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of nucleotides…

Q: DNA replication occurs during Select an answer and submit. For keyboard navigation, use the up/down…

A: DNA replication is the process by which DNA makes copies of itself during cell division. It is one…

Q: Which of the following are essential to the condensation of chromosomes as cells enter mitosis?a)…

A: Mitosis is a process of cell division in which a cell nucleus splits into two resulting in the…

Q: Chromosomes attach to the spindle during

A: Phases of cell division include :  Prophase  Metaphase  Anaphase  Telophase  Option a ( anaphase )…

Q: The nucleus  a) has a single membrane and compartmentalizes the genetic material b) has a double…

A: The nucleus is a membrane-bound organelle found in eukaryotic cells. It contains the cell's genetic…

Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…

A: This represents central dogma of molecular biology. It shows the flow of genetic information from…

Q: Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?a)…

A: The nucleolus is a round body located inside the nucleus of a eukaryotic cell. It is not surrounded…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Chemical mutagens often cause oxidation or deamination of DNA bases. This can lead to cancer by…

A: DNA damage is often caused by external sources like radiation exposure, exogenous chemical reactions…

Q: dentify two important enzymes involved in the replication.

A: There are two important enzyme involved in the replication of DNA DNA Polymerase primase DNA…

Q: a) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e)…

A: DNA, or deoxyribonucleic acid, is a molecule that contains the instructions an organism needs to…

Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…

A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…

Q: 14) Why are telomeres so important in eukaryotic organisms: A) Without telomeres, important DNA…

A: Telomeres are the section of a chromosome that is found at the end and does not contain any genetic…

Q: The nucleus is the largest of the eukaryotic organelles and contains the genome of the organism.…

A: When viewing a cell picture, the nucleus is one of the most prominent features. The nucleus is found…

Q: Where, in a eukaryotic cell, should functional tRNA molecules be located?  A) RNA polymerase  B)…

A: INTRODUCTION tRNA tRNA is a type of RNA that decode the messenger RNA and helps to make the protein.

Q: Name the three main stages of S phase/DNA replication.

A: DNA replication is the process by which a cell makes an identical copy of its DNA. This is a crucial…

Q: 5) The process by which a cell copies its DNA before it divides is called: A) DNA replication B)…

A: DNA replication happens in the (centrosome/core) of an eukaryotic cell. DNA is repeated during the…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.