What protein is responsible for reading the mrna strand and creates protein(polypeptide)

Q: The triplet UGA in mRNA causes: Choose ome a mutation in a protein   translation to stop…

A: The question is asking about the role of the triplet UGA in mRNA during protein synthesis. mRNA, or…

Q: What occurs during transcription? Where in the cell does this take place?

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Which process of gene regulation specifically effects the activity of a protein?     DNA…

A: Introduction :- A gene is a unit of heredity that carries genetic information from one generation to…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…

A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…

Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…

A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: Describe the genetic code and how the nucleotide sequence determines the amino acid and the protein…

A: Genes are the unit of hereditary which are present in a thousand of numbers on the stand of DNA…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: What determines the sequence of nucleotides in the mRNA strand?

A: The process of converting the genetic information in the mRNA or messenger RNA into a protein is…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: Which of the following is least likely following translation termination? The polypeptide is…

A: Introduction: Translation of termination is process in  which the genetic code is  within a…

Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: During

A: Ans) During transcription, the coding strand is the same sequence as the newly synthesized mRNA…

Q: When production of a protein product from the mRNA is controlled by modifying the mRNA after it…

A: Post-transcriptional gene regulation is the regulation of a gene's expression at the RNA level; it…

Q: How is the relationship between the tRNA and mRNA described

A: Messenger RNA is product of transcription process. A process where all the genetic information of…

Q: Describe and explain (step by step) how DNA is Transcribed into mRNA. Then describe and explain…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Several ribosomes attached to one mRNA,which they are all transcribing, form acluster called a/an

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It is passed on from one…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Amino acids are carried to the ribosome attached to molecules called initiation factors

A: For each amino acid, a group of organic molecules consisting of a basic amino group, an acidic…

Q: Why exosome complex destroys the mRNA ?

A: Exosomes are defined as vesicles which are nano metric-sized, being packed as biomolecules ranging…

Q: mRNA does which of the following?   bring genetic information from the nucleus to the cytoplasm…

A: mRNA helps in transfer of genetic information from nucleus to cytoplasm so that translation can take…

Q: what 3 parts make up processed piece of mRNA

A: A post-transcriptional modification takes place after transcription of DNA to mRNA strand in the…

Q: The exact start site for protein synthesis on the mRNA is AUG and base pairs with a tRNA carrying…

A: A codon is a sequence of three nucleotides (adenine, cytosine, guanine, or uracil) in DNA or RNA…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: Name all components you would find in a fully assembled ribosome during elongation of protein…

A: Protein synthesis or translation consists of three stages - initiation, elongation and termination.…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: In order to know which proteins to build for a cell, RNA must locate (choose as many as apply)…

A: Gene expression is a complex process that involve replication, transcription and translation.…

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: What is exactly done during the process of RNA processing

A: The RNA molecules undergo certain changes after their synthesis known as RNA processing. Both…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.