What protein is responsible for reading the mrna strand and creates protein(polypeptide)

Q: The triplet UGA in mRNA causes: Choose ome a mutation in a protein   translation to stop…

A: The question is asking about the role of the triplet UGA in mRNA during protein synthesis. mRNA, or…

Q: Which of the following acts as the “transcript” during protein synthesis?

A: Proteins are large biomolecules i.e. macromolecules. They are polymers of amino acids

Q: Which process of gene regulation specifically effects the activity of a protein?     DNA…

A: Introduction :- A gene is a unit of heredity that carries genetic information from one generation to…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: How is tRNA involved in protein synthesis? How genetic code helps

A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Describe the mRNA journey through the cell after the nucleus has given the instructions.  Describe…

A: The information contained in a gene's DNA is transferred to an analogous molecule called RNA…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: What is the process of Translation

A: The natural data flows from DNA to RNA, and from that point to proteins. This is the central dogma…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: What determines the sequence of nucleotides in the mRNA strand?

A: The process of converting the genetic information in the mRNA or messenger RNA into a protein is…

Q: If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA…

A: DNA is made up of 4 bases A, T, G, and C. A Pairs with T and G pairs with C. In the case of RNA, the…

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: During

A: Ans) During transcription, the coding strand is the same sequence as the newly synthesized mRNA…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: How is the relationship between the tRNA and mRNA described

A: Messenger RNA is product of transcription process. A process where all the genetic information of…

Q: Several ribosomes attached to one mRNA,which they are all transcribing, form acluster called a/an

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It is passed on from one…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…

A: The process of gene expression involves two steps: transcription and translation. Translation is the…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: What is genetic code? How many codons are there? Justify that genetic code is universal

A: The study of genomes' structure, operation, development, the mapping process, and modification is…

Q: mRNA does which of the following?   bring genetic information from the nucleus to the cytoplasm…

A: mRNA helps in transfer of genetic information from nucleus to cytoplasm so that translation can take…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: The exact start site for protein synthesis on the mRNA is AUG and base pairs with a tRNA carrying…

A: A codon is a sequence of three nucleotides (adenine, cytosine, guanine, or uracil) in DNA or RNA…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: Name all components you would find in a fully assembled ribosome during elongation of protein…

A: Protein synthesis or translation consists of three stages - initiation, elongation and termination.…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: In order to know which proteins to build for a cell, RNA must locate (choose as many as apply)…

A: Gene expression is a complex process that involve replication, transcription and translation.…

Q: Put the following events involved with protein synthesis in order. Move first event to the top of…

A:

Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA

A: Gene expression is the process through which data from a gene is employed in the synthesis of a…

Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?

A: The process of transcription starts as the DNA of a gene serves as a template for complementary…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.