The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a polymerase enzyme a DNA gene

Q: Which of the following acts as the “transcript” during protein synthesis?

A: Proteins are large biomolecules i.e. macromolecules. They are polymers of amino acids

Q: Define the term messenger RNA (mRNA)?

A: Transcription and translation are 2 steps involved in processing of DNA to proteins. RNA molecule is…

Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…

A: The translation process completes in three main steps. they are initiation, elongation, and…

Q: Which of the following statements about RNA are true?

A:

Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…

A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…

A: Replication, transcription, translation are the three processes of central dogma of life.…

Q: When a protein is being assembled in the monosome, the bond that forms between a newly added amino…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…

A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…

Q: Describe the synthesis and processing of mRNAs.

A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA…

A: DNA is made up of 4 bases A, T, G, and C. A Pairs with T and G pairs with C. In the case of RNA, the…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Explain how the genetic code stored within DNA determines the protein that will form

A: Proteins are the building blocks of cells and play crucial role in physiology due to the involvement…

Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…

A:

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: e ribosome in the diagram is in the process of synthesizing a protein using directions transcribed…

A: Translation is the process via which the protein is synthesized using mRNA as the template.In this…

Q: After mRNA is made, enzymes remove introns and splice together exons in a variety of ways. This…

A: The DNA can be transcribed into the RNA which is known as the ribonucleic acid by the process of…

Q: Explain the roles of DNA, mRNA, tRNA, and rRNA in theproduction of a protein

A: Proteins are large biomolecules that play a significant role in the physiological activities of the…

Q: The function of a gene is dictates the primary structure of a protein dictates the nucleotide…

A: Proteins :  Primary structure of proteins is the sequence of amino acids in a polypeptide chain.…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: These molecules serve as the set of master instructions for building proteins tRNA DNA Ribosomal…

A: Introduction :  Proteins are complex macromolecules made up of simpler building blocks called amino…

Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…

A: It is the process of the formation of proteins by the process of Translation. The proteins are…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: Briefly explain the two processes of transcription and translation and highlight the roles of the…

A: Transcription is a process in which RNA is synthesised with the help of template strand of DNA.…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation  mRna have to be…

Q: Describe  the relationship between

A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar.  The mRNA…

Q: Amino acids are carried to the ribosome attached to molecules called initiation factors

A: For each amino acid, a group of organic molecules consisting of a basic amino group, an acidic…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: If the sequence of bases on a strand of mRNA is UUAAGCCAAGGG, then the sequence of the amino acids…

A: Proteins are linear, unbranched polymers of amino acids. These amino acids are connected to each…

Q: Name all components you would find in a fully assembled ribosome during elongation of protein…

A: Protein synthesis or translation consists of three stages - initiation, elongation and termination.…

Q: make(s) proteins while . carry amino acids MRNA : TRNAS ribosomes : TRNAS TRNAS : ribosomes Enzymes…

A: The DNA is the genetic material of the organism like humans. The DNA is transcribed into the RNA by…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: The folding of some protein was monitored as a function of the time it takes for the protein to…

A: The proteins can be modified by different modifications and this modification can affect the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.