The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a polymerase enzyme a DNA gene

Q: Which of the following acts as the “transcript” during protein synthesis?

A: Proteins are large biomolecules i.e. macromolecules. They are polymers of amino acids

Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…

A: The translation process completes in three main steps. they are initiation, elongation, and…

Q: Which of the following statements about RNA are true?

A:

Q: Which process of gene regulation specifically effects the activity of a protein?     DNA…

A: Introduction :- A gene is a unit of heredity that carries genetic information from one generation to…

Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…

A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT   Give the mRNA…

A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA  and…

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: Describe the genetic code and how the nucleotide sequence determines the amino acid and the protein…

A: Genes are the unit of hereditary which are present in a thousand of numbers on the stand of DNA…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Explain the roles of DNA, mRNA, tRNA, and rRNA in theproduction of a protein

A: Proteins are large biomolecules that play a significant role in the physiological activities of the…

Q: The function of a gene is dictates the primary structure of a protein dictates the nucleotide…

A: Proteins :  Primary structure of proteins is the sequence of amino acids in a polypeptide chain.…

Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…

A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: describe how ribosomes, mRNA, and tRNA cooperate to produce a protein?

A: Ans: The proteins are synthesized from mRNA using the process called translation, which involves…

Q: These molecules serve as the set of master instructions for building proteins tRNA DNA Ribosomal…

A: Introduction :  Proteins are complex macromolecules made up of simpler building blocks called amino…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…

A: It is the process of the formation of proteins by the process of Translation. The proteins are…

Q: Briefly explain the two processes of transcription and translation and highlight the roles of the…

A: Transcription is a process in which RNA is synthesised with the help of template strand of DNA.…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: Protein synthesis takes place via a process called translation . Before translation  mRna have to be…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Amino acids are carried to the ribosome attached to molecules called initiation factors

A: For each amino acid, a group of organic molecules consisting of a basic amino group, an acidic…

Q: mRNA does which of the following?   bring genetic information from the nucleus to the cytoplasm…

A: mRNA helps in transfer of genetic information from nucleus to cytoplasm so that translation can take…

Q: Which of the following is NOT a ribonucleoprotein (protein-RNA complex)? Select an answer and…

A: Option (b) - RNA polymerase II is not a ribonucleoprotein.   RNA polymerase II is an important…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: Messenger RNA Iis single-stranded molecule while RNA and rRNA molecules are double-stranded…

A: Ribonucleic acid (RNA) is a biomolecule that takes part in a wide array of biological roles.

Q: If the sequence of bases on a strand of mRNA is UUAAGCCAAGGG, then the sequence of the amino acids…

A: Proteins are linear, unbranched polymers of amino acids. These amino acids are connected to each…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: make(s) proteins while . carry amino acids MRNA : TRNAS ribosomes : TRNAS TRNAS : ribosomes Enzymes…

A: The DNA is the genetic material of the organism like humans. The DNA is transcribed into the RNA by…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: The folding of some protein was monitored as a function of the time it takes for the protein to…

A: The proteins can be modified by different modifications and this modification can affect the…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: The cells are the basic biological structural and functional units of life. These cells of the body…

Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…

A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…

Q: Break down the mRNA strand into tRNA anticodons. Which series is correct? 6 ACCUAC CHIA CHIC AUC

A: Translating mRNA to tRNA: Decoding the Genetic MessageThe central dogma of molecular biology…

Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…

A: The figure is showing the process of translation. Translation is the process of formation of a…

Q: Which of the following is not a factor in the lifetime of a protein? ANSWER…

A: The average lifetime of cellular proteins ranges from 3 to 13 days, following which the proteins…

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: list all the steps required for mRNA to be translated into a protein

A: The process by which genetic information encoded in messenger RNA (mRNA) is converted into a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.