Q: I believe that the answer is p+q=1 under the Hardy-Weinberg Equilibrium. I just want to make sure…
A: Yes, you are right.?
Q: Monozygotic twins: Question 2 options: a) Share 50% of their genetic material and if one twin…
A: Genes are the basic structural and functional units of heredity. They are composed of DNA and they…
Q: Can you please help answer this question base on the graph it shows?
A: In the image given, a scatter plot has been shown which shows a significant correlation between mean…
Q: What are the answers in number 4 & 5?
A: Nucleic acids are important macromolecules that comprise carbon, hydrogen, oxygen, phosphorus, and…
Q: Do questions solve this problem
A: Nutritional assessment serves as a crucial clinical tool for the identification of clients who…
Q: These Three questions are also in relation to the graph.
A: The given graph is of rate of immigration and extinction in two islands A and B. Using the graph,…
Q: What happens to r as N approaches K? Why?
A: while we study density depended growth , we know that there is certain limitations for growth of…
Q: What are the allele frequencies for the gene that controls coat color in Rhosgobel rabbits?
A: Allele frequency of an allele is the proportion of a specific allele within a population. It is…
Q: Various OR team members and how do that interrelate
A: Operating room Operating room is also called as operating theatre, operating suite or operation…
Q: In the hawk-dove game, at what value of c do doves and hawks have equal payoffs when hawks are…
A: ANSWER;- In the hawk-dove game, doves and hawks have equal payoffs if c=0.
Q: Suppose that the mean IQ in the United States is roughly 100 and the standard deviation is 15…
A: An IQ is an all-out score got from a bunch of standardized tests or subtests intended to evaluate…
Q: What does contrast mean
A: Contrast is a phenomenon that has great application in optical microscopy. It is studied under the…
Q: QUESTION 8 "Optimal behavior is the maximum value, given:" (A) Benefit - cost (B) Cost - benefit (C)…
A: The correct option is B Cost -Benefit Cost-benefit analysis as applied to animal behavior pre-…
Q: this is my punnet square how do I fill in the rest of the chart for my expect and so on
A: Purple maize = CI_R_ Yellow maize = CI_rr, ciciR_, cicirr
Q: Question 26 Which of the following organisms are NOT considered an "R-strategist"? Roaches B Spiders…
A: as giraffe state the K strategistsas the K strategists are : long life spanlarge body sizehave few…
Q: What happens at 37 degree and why is it significant was not really answered
A: The temperature of a person's body varies depending on their age, activity level, and time of day.…
Q: What prompt you to participate in research survey? and also the counter:what prompt you to not…
A: Research survey is used to collect primary data for the analysis of data thereby helps in finding…
Q: What is the answer to number 4?
A: The fluid deprivation test is a standard test to measure the formation and concentration of urine…
Q: How does a graph help us? What are they good for?
A: A graph is a diagram which represents the relationship between two data's or variables, each of the…
Q: would decrease r. would increase r.
A: Exponential growth assumes the environmental factors like food, water, space, shelter, natural…
Q: Why the percentages change results are positive and negative .
A: Given: The Percentages change results are positive and negative.
Q: MAP= CO x TPR / 80 I don't understand the value of TPR how do I get this number?
A: Mean arterial pressure is the the average blood pressure in an individual during one cardiac cycle.…
Q: if something is 1g/hr how many μg/s is it? Give the first 3 digits of your answer.?
A: Mathematical calculations and conversions are very important in the field of biochemistry in that…
Q: What is the next number in the series? 131 118 105 92 79 _?_
A: Series and sequence are part of arithmetic. Solving these problems sharpens the cognitive skills of…
Q: Interprete the implication and possible explanations for the results
A: We can see differential growth of different bacteria on the same agar slant.
Q: Please provide a supportive statement about why you picked each of the two curves you picked. Your…
A: Thermophilic bacteria are those bacteria that can live in a High temperature environment. Like…
Q: QUESTION 2 Given the following information, what would be considered to be the positive control in…
A: 2. Positive control in an experiment is a group that receives treatment with a known result and it…
Q: How would I get the average
A: Average for Cold bath temperature = 82+88+85/3 = 85 Average for Room temperature = 110+115+116/3 =…
Q: What does the SMART acronym mean, and why do we use it to set goals?
A: Setting goals aids in the development of new habits, the concentration of attention, and the…
Q: What are the predictions given by the Hardy–Weinberg law?
A: Hardy-Weinberg principle predicts the probability of occurrence of an allele by determining the…
Q: Discuss what the difference between q and q2 means for Hardy Weinberg equilibrium using fur color…
A: Each and every character that is expressed by an individual is due to the gene present in the…
Q: n the previous question (PpYyRr * Ppyyrr), compute the following probabilities. SHOW YOUR SOLUTIONS
A: The given plant is triploid. Symbol For purple = PP(dominant) For yellow seed = YY(dominant) For…
Q: When thinking about changes in allele frequencies over time, why do you care more about the…
A: Effective population size (Ne) : To identify the number of gametes that contribute to the next…
Q: A correlation coefficient of -0.92 indicates that... Two variables strongly change with one another…
A: The coefficient of correlation depicts the relationship between two variables.
Q: Solve this question where use a and an
A: Article: Member of a class of dedicated words. These are commonly used with noun phrases. These are…
Q: How would I number it on the graph to put the averages on there
A: The operculum is a thin bony flap that covers the gills. It is protective in function and it helps…
Q: Draw a graph based on the result. And give a short discussion
A: The growth of bacterial cells in culture can be assessed using the spectrophotometric method. In…
Q: Question 9 What are analogous structures? similar structures with identical uses similar structures…
A: Morphology and comparative anatomy study have provided us with various evidences which has helped…
Q: following wo
A: Vitamin K is an essential micronutrient required by the human body as it helps in the clotting…
Q: Compare and contrast HMO versus PPO. What are their pros and cons?
A: The managed care plan is a good option for cost reduction of health insurance. Managed-care plans…
Q: Both question correlate with each other
A: Single-nucleotide polymorphisms (SNPs) are single- nucleotide differences between two DNA molecules.…
Q: In your own words, describe the difference between continuous and discrete data sets. What is the…
A: The variable is an algebraic phrase used to refer to an unspecified amount that is not a fixed…
Q: QUESTION 44 Which is not a component of Health Related Fitness? O a. Cardiorespiratory Fitness O b.…
A: Answer D) Reaction time
Q: Please answer asap and in short 3. What is the caloric cost of 30 min of running at a VO2 of 1.5…
A: Answer :- To calculate caloric cost, Formula is, Kcal = VO2 (L/min) x RER caloric equivalent x time…
Q: What do you think the additives do? What effect will they have? answer
A: Additive or food additives Food additives are those chemical compounds that is use to keep food…
Q: Question 10 What is meant by 'social devaluation' and how does this affect an older person's quality…
A: Societal evaluation of our personas plays a vital role in maintaining our emotional well-being. As…
Q: What does P-value indicate? In statistical analysis the results for two sets of data are presented…
A: In statistics the p-value or probability value is the probability of obtaining the test results as…
Q: What is represented by the blue line on the graph
A: Greenhouse effect is the phenomenon by which the earth atmosphere traps the sun's radiation and…
The process of DNA replication is semi-conservative. It is studied under the domain of molecular biology.
Step by step
Solved in 2 steps with 2 images
- erm test Fall 2020 (page 1 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149 -aming System (Academic) Fon 3 "DNA is passed from one generation to another during cells division after DNA replication". et red which of the following statements regarding DNA replication is NOT correct: d out of Select one: O a. Each DNA strand of the double helix will be copied g question O b. The newly synthesized strand will have the complementary sequence of the parental template strand O c. The daughter cell will have doub the amount of DNA that the parental cell had n 4 Which of the following ketoses contain the same number of carbons as glucose? ed Select one: out of O a. Sucrose O b. Fructose question O c. Ribose O d. Galactose O e. Aldose 5) helps maintaining the skin's cells and prevents the growth of someDNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG
- to 4 minutes) The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated 31 parental duplex 5' 3' fork progression v A 1Lagging strand 2. An Okazaki tragment 3.Site of action of DNA topoisomerase 4 Leading strand 5. Site of action of DNA helicCase 6.Site of action of DNA ligaseDNA WORKSHEET Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided below: 1. ATAGGTCACCGTAA 2. TCCAGA
- Paternity Test: Alanna claims John is the father of Timmy, but Leo thinks that he is the father. All of their DNA samples were taken and cut with the same restriction enzyme and run through a gel. 4. Who is the father of Timmy? 5. How many of Timmy's fragments are the same size as his mother's fragments? 6. Whatactually causes the DNA pieces to move through the gel? 7. Describe the difference you see in the gel between John's DNA and Leo's DNA. Alanna's DNA Timmy's DNA John's DNA Leo's DNAAnswer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتبProcedure: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA A AGACCGTATAC mRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2 How does this protein help the body maintain homeostasis2
- time and read each question carefully. This is an independent test Question 1 1. If 30% of DNA is Adenine, what percent is Thymine? O 30% O 20% O 40%☆回 w Insert Format Tools Add-ons Help Last edit was yesterday at 8:08 AM TURN 100% Normal text Arial 11 BIUA E- 1E E E - E EX 2. 3 . 5. C Directions: Describe the process of DNA replication in the space below. Specifically reference the pictures in your answer. Your response will undergo a plagiarism check. Be sure to write your response in your own words. Be sure to reference and thoroughly explain: The relationship and importance of DNA replication and the cell cycle. The conservation of genetic information during replication. (Is it conservative? Semi-conservation? Dispersive? What does this mean?) The specific enzymes used in each step and indicate whether each of the enzymes is a synthesis reaction or a digestion reaction. Justify your answer through explanation. Identify the parameters and limitations of the enzymes working effectively. (What factors would limit or interfere with DNA replication?)DNA Replication, Sequencing, and Recombination - PowerPoint Karla Henthorn KH Animations Slide Show Review View Help O Tell me what you want to do A A E. s et Direction- Align Text Shape Fill O Find US abs AV- Aa - ay. A- Stiape Outine- ab Replace- ne Arrange Quick Styles Convert to SmartArt Shape Effects A Se Font Paragraph Drawing 6 5 4 1 3 Ec 2 1 2 3 H4 Kim ACTIVITY Consider the following DNA molecule: ACG GTACACTTA C G A A Henthorn, ic T GCCAT GT GA ATG CT T Rc 1) Draw the 2 strands after they have "unzipped". 2) Follow the rules for pairing and fill in the new strands with the correct nitrogenous bases. Write these new strands in a different color of ink. = Notes Comments 可 DO DELL