Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided below: 1. ATAGGTCACCGTAA 2. TCCAGA

DNA WORKSHEET Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.

384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write answers in your own words (don't copy the answers directly) Choose one of the questions below to write a follow-up question Structure and Function of DNA and RNA Q2.1- Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding? Amino Acids and Peptides Q2.2-Using Table 4.3, list the amino acids that will carry a net charge at pH 7 within a protein. What is the charge at pH 7 for each of the amino acids you have listed (-2, -1, +1, etc.)? What is the net charge at pH 7 of the tetrapeptide shown in figure 4.17?

answeres below are wrong, i need help identifying the correct order. Thank you!