What does next generation rna seq technology determine?   difference of expression between two alleles of same gene   change of stability of protein in cell post modifioon specific gene   all above   none above

When performing QPCR to study differential gene expression, what is the role of SYBR green? What is the most correct answer? SYBRgreen intercalates proportionally and efficiently with double stranded DNA and can therefore be used to quantify it   SYBRgreen intercalates proportionally and efficiently with nucleic acids and can therefore be used to quantify them.   SYBRgreen intercalates more efficiently and proportionately with single stranded DNA and can therefore be used to quantify cDNA (a direct product of mRNA).   SYBRgreen intercalates proportionally efficiently with messenger RNA and can therefore be used to quantify it.

What is the function of gRNA in CRISPR-Cas technologies?It cuts DNA at a targeted sequence and inserts a new sequence -.It cuts protein at a targeted sequence and inserts a new sequence.It ensures the Cas9 enzyme cuts at the correct place in the DNA.It ensures the Cas9 enzyme cuts at the correct place in the RNA.It replaces uracil nucleotides with thymine nucleotides.

CRISPR-Cas9 provides an unprecedented means of modifying the genome of almost any organism. Which of the following component(s) of this system contribute to the specificity of the endonucleolytic cleavage Options:   the sequence of the sgRNA   the PAM sequence   Cas9   a and b   a, b and c

Based on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3? Also do they have any identical amino acids to prove a mouse is the best model to test the fgfr3 gene?

design a molecular beacon probe (15-20 NT long) for qPCR of the gene   5`- AACTATATTTACACTTGTCACTACTTTCGGTTATGGTGTTCAATCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGTTACATTCTTGGACACAAATTGGAATACAACT-3`

How would you go about cloning this amplified DNA into pL4440？Using your knowledge of cloning describe 5 important aspects of the method in details

53.  What is the benefit of a gene “knockout”?  MARK ALL THAT APPLY. Group of answer choices It allows you to identify the function of a gene within an organism It is easily accomplished by using the Cas9 protein alone without guide RNA It helps you develop in vitro assays to study the function of a gene Can determine the level of expression of a gene within an organism The genotype can be easily observed from the survival and behavior of the knockout organisms

In the following "gene library" cloning experiment Digested genomic DNA AmpR gene TCR gene TCR is tetracycline resistant marker, AmpR is ampicillin resistant marker and BamHI is the unique restriction enzyme on plasmid. A PhD student digests/cuts the plasmids with BamHI restriction enzyme and the genomic DNA with EcoRI restriction enzyme. After performing the cloning experiment and obtaining colonies on a selection plate, the obtained cells will be ..... (Hint: this question is even more challenging; the PhD student was later demoted to an MSc student). a) resistant to ampicillin and tetracycline b) sensitive to tetracycline and ampicillin c) resistant to tetracycline and sensitive to ampicillin d) resistant to ampicillin and sensitive to tetracycline e) sensitive to ampicillin and tetracycline BamHI

If a researcher wanted to utilize CRISPR/Cas9 to target a gene of interest in their experimental system (i.e. Drosophila) which of the following would they customize for this purpose Group of answer choices Guiding region of sgRNA None of the above, CRISPR can only function in bacterial cells Cas9 enzyme Scaffold region of sgRNA