
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
What does next generation rna seq technology determine?
difference of expression between two alleles of same gene
change of stability of protein in cell
post modifioon specific gene
all above
none above
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- how to design an experiment to test weather the mutation is on enhancer, promoter, or protein-coding region?arrow_forward12arrow_forwardIn a microarray experiment, if you label cDNA from Tissue #1 with a red color and cDNA from tissue #2 with a green color and perform a microarray, predict the following gene expression patterns? : A dot that is only red? A dot that is only green? A dot that is only yellow? A dot that is black?arrow_forward
- When performing QPCR to study differential gene expression, what is the role of SYBR green? What is the most correct answer? SYBRgreen intercalates proportionally and efficiently with double stranded DNA and can therefore be used to quantify it SYBRgreen intercalates proportionally and efficiently with nucleic acids and can therefore be used to quantify them. SYBRgreen intercalates more efficiently and proportionately with single stranded DNA and can therefore be used to quantify cDNA (a direct product of mRNA). SYBRgreen intercalates proportionally efficiently with messenger RNA and can therefore be used to quantify it.arrow_forwardWhat is the function of gRNA in CRISPR-Cas technologies?It cuts DNA at a targeted sequence and inserts a new sequence -.It cuts protein at a targeted sequence and inserts a new sequence.It ensures the Cas9 enzyme cuts at the correct place in the DNA.It ensures the Cas9 enzyme cuts at the correct place in the RNA.It replaces uracil nucleotides with thymine nucleotides.arrow_forwardCRISPR-Cas9 provides an unprecedented means of modifying the genome of almost any organism. Which of the following component(s) of this system contribute to the specificity of the endonucleolytic cleavage Options: the sequence of the sgRNA the PAM sequence Cas9 a and b a, b and carrow_forward
- Based on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3? Also do they have any identical amino acids to prove a mouse is the best model to test the fgfr3 gene?arrow_forwarddesign a molecular beacon probe (15-20 NT long) for qPCR of the gene 5`- AACTATATTTACACTTGTCACTACTTTCGGTTATGGTGTTCAATCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGTTACATTCTTGGACACAAATTGGAATACAACT-3`arrow_forwardHow would you go about cloning this amplified DNA into pL4440?Using your knowledge of cloning describe 5 important aspects of the method in detailsarrow_forward
- 53. What is the benefit of a gene “knockout”? MARK ALL THAT APPLY. Group of answer choices It allows you to identify the function of a gene within an organism It is easily accomplished by using the Cas9 protein alone without guide RNA It helps you develop in vitro assays to study the function of a gene Can determine the level of expression of a gene within an organism The genotype can be easily observed from the survival and behavior of the knockout organismsarrow_forwardIn the following "gene library" cloning experiment Digested genomic DNA AmpR gene TCR gene TCR is tetracycline resistant marker, AmpR is ampicillin resistant marker and BamHI is the unique restriction enzyme on plasmid. A PhD student digests/cuts the plasmids with BamHI restriction enzyme and the genomic DNA with EcoRI restriction enzyme. After performing the cloning experiment and obtaining colonies on a selection plate, the obtained cells will be ..... (Hint: this question is even more challenging; the PhD student was later demoted to an MSc student). a) resistant to ampicillin and tetracycline b) sensitive to tetracycline and ampicillin c) resistant to tetracycline and sensitive to ampicillin d) resistant to ampicillin and sensitive to tetracycline e) sensitive to ampicillin and tetracycline BamHIarrow_forwardIf a researcher wanted to utilize CRISPR/Cas9 to target a gene of interest in their experimental system (i.e. Drosophila) which of the following would they customize for this purpose Group of answer choices Guiding region of sgRNA None of the above, CRISPR can only function in bacterial cells Cas9 enzyme Scaffold region of sgRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education