What can proteomics reveal that genomics cannot? the set of proteins present within a cell or tissue type the movement of transposable elements within the genome the levels of mRNAs present in a particular cell type the number of genes characteristic of a species the patterns of alternative splicing

What can proteomics reveal that genomics cannot? the set of proteins present within a cell or tissue type the movement of transposable elements within the genome the levels of mRNAs present in a particular cell type the number of genes characteristic of a species the patterns of alternative splicing

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 16QP

See similar textbooks

Similar questions

IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the MRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference? Explain in detail. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). A Ix BIUS Paragraph Arial 14px
Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such “microexons” isdifficult because these distances are too short to reliablyuse ORF identification or codon bias to determine ifsmall genomic sequences are truly part of an mRNAand a polypeptide. What techniques of “gene finding”can be used to try to assess if a given region of 75 bpconstitutes an exon?
After sequencing a new genome for the first time, functional protein-coding genes are initially identified by: BLAST searches that look for viral integration in the host genome Bioinformatic searches that reveal consensus sequences in expressed genes Aligning expressed exons sequenced from cDNA using transcriptomics B and C A and B Many regions of non-coding eukaryotic DNA previously thought to be "junk" are now known to contain sequence elements important to regulating gene expression. What approach can be used to identify important non-coding regulatory regions when annotating a newly sequenced genome? comparing cDNA to genomic DNA to validate that the gene is expressed identifying restriction enzyme recognition sequences in the genome phylogenetic footprinting to identify conserved non-coding sequences searching for start/stop codons and splice recognition sites that predict where a gene might be located…
One of the challenges of studying RNA is the rapid degeneration of RNA. While the half-life of mRNA depends on the solutionit is in, in situ the half life of mRNA is between 5 minutes (E. coli) and 25 minutes (S. cerevisiae). When performing gene expression analyses it is important to make sure you can freeze a sample of mRNA in liquid nitrogen (halting mRNA decay) rapidly as to not loose too much of the original expression. Answer question A and B in order to answer the attached image questions Poll 1 and 2. A. You are doing an experiment with E. coli, what is the decay mRNA decay rate? B. If the sample initially has 0.25 pico-moles or mRNA, how much will remain in the sample if you freeze it 3 minutes later? See attached image for next question. Answer the two green poll questions please!!
With regard to RNA polymerase proofreading ability, which of the following is true? A 3'5' exonuclease fixes all errors in mRNA. There are specialized mRNA repair pathways that remove noncomplementary nuclec No proofreading occurs. RNA backtracking can remove noncomplementary nucleotides. RNA and DNA polymerase proofreading are essentially identical. OOOOO
A portion of the coding sequence of a cloned gene is shown here:5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄This portion of the gene encodes a polypeptide with the aminoacid sequence alanine–proline–aspartic acid–leucine–histidine–histidine–tyrosine–glycine–aspartic acid. Using the method ofsite- directed mutagenesis, a researcher wants to change the leucinecodon into an arginine codon, using an oligonucleotide that is19 nucleotides long. What is the sequence of the oligonucleotidethat should be used? Designate the 5′ and 3′ ends of the oligonucleotidein your answer. Note: The mismatch should be in the middleof the oligonucleotide, and a 1-base mismatch is preferableover a 2- or 3-base mismatch. Use the bottom strand as the templatestrand for this site-directed mutagenesis experiment.
You synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude from this data? Select all that apply. You may select multiple options. These pre-mRNAs were incubated with a nuclear extract and splicing over time (0-120 min) was followed by gel electrophoresis. m7GpppG 0 30 60 120 O None of these options m'Gppp 13- Gppp 13- (uncapped)13- GpppG 0 30 60 120 O Cap affects the splicing of the second intron O Cap affects the splicing of the first intron Cap affects splicing of all introns Cap has no effect on splicing exon intron uncapped 0 30 60 120 min Fig. 15.29 13 14 13 14 15 (0) 15 13 14 13 14 15 (4) 15 (0) Fig. 15.30
Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries I use a comparative genomic approach and use sequence homology with the genome of a closely related species I use a comparative genomic approach and use sequence homology with the genome of a distantly related species Both A and B Both B and C Why did you bother to identify the introns? So that I could include them in the sequence to understand intron function. So that I could exclude them from the sequence because prokaryotes don't have spliceosomal machinery. So that I could see how introns affect protein folding.
A scientist seeks to synthesize a blood clotting factor protein in lab. To perform this experiment,she utilizes recombinant DNA technology where she inserts the gene of interest encoding for theparticular protein from a eukaryotic cell into bacterial plasmids. These plasmids are thesetransformed into E.coli for expression. During structural elucidation of the product, she isdisappointed to discover that the gene product from the bacteria is not the correct protein. Whatcorrective step could she take in the procedure to fix this issue? Justify your answer.
NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?
Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen acci-dent, while others have argued that it was shaped by nat-ural selection. A striking feature of the genetic code is itsinherent resistance to the effects of mutation. For example,a change in the third position of a codon often specifies thesame amino acid or one with similar chemical properties.The natural code resists mutation more effectively (is lesssusceptible to error) than most other possible versions, asillustrated in Figure Q1–1. Only one in a million comput-er-generated “random” codes is more error-resistant thanthe natural genetic code. Does the extraordinary mutationresistance of the genetic code argue in favor of its origin asa frozen accident or as a result of natural selection? Explainyour reasoning.