Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…
A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…
Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…
A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…
Q: 2. Discuss the use of transposons as mutagens in bacteria.
A: Transposable elements are segments of DNA that can move around the genome. Classification of…
Q: 3. List the sequences for the "stop" codons.
A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…
Q: 3. What is a restriction digest? What does it mean if you were given a precut DNA? 4. What is…
A: Restriction digest It is the process of cutting DNA molecules into smaller pieces with special…
Q: 4. What makes the genetic modification of corn and bacterial cells similar to each other?
A: 4th Answer
Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA
A:
Q: 1. Why is it that every cell needs to contain the DNA for the entire body when only a few of its…
A: DNA holds all of an organism's directions for growth, survival, and reproduction. DNA sequences…
Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: what is The entire complement of DNA sequences in an organism.?
A: Genome
Q: 3. Which of the following processes involves DNA ligase? A. Primer synthesis B. Removal of DNA…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA is a…
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: 3. Explain the differences between a point mutation and a frameshift mutation.
A: Mutation - A mutation is the condition during which there is any damage to the gene / DNA as a…
Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…
Q: 3. A mutation in a DNA sequence produced a new protein with an amino acid sequence that differs from…
A:
Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?
A: DNA is the store house of genetic information. This genetic information expressed by the formation…
Q: 2. Describe what is meant be the antiparallel arrangement of DNA.
A: The double helix model of DNA was the famous and most valuable discovery by Watson and Crick. This…
Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…
A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…
Q: 2. How does the universality of the genetic code make the recombinant DNA technology possible?
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…
A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…
Q: 6. Do you think scientists would extract human DNA the same way you extracted fruit DNA? Explain.…
A: The DNA extraction is the method by which the DNA is taken out from the nucleus of the cell by…
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: . An alternative form of a gene is called an
A:
Q: 4. Why do the dideoxynucleotides stop DNA extension?
A: The sequences of nucleotides on the DNA strand (dNTPs) constitute the genetic code or genome. The…
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14…
Q: 3. Give the different hydrolytic products of : a. DNA b. RNA
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: 1. What is a mutation? A. the specific sequence of bases in a molecule of DNA B. a change in the…
A: A mutation arise spontaneously at low frequency owing to chemical instability of purine and…
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: 7) The Human Genome project cost billions of dollars to complete. What was it and do you think it…
A: For long, many people thought of the Human Genome Project as biology's "moon shot." The United…
Q: 5. How does silent mutation affect protein production in the cell? Silent mutation A. changes the…
A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: Explain the following relationship: DNA formats RNA, which makes proteins.
A: DNA and RNA are two types of nucleic acids. DNA provides the code for the cellular activities while…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 11) How would an organism be impacted by an error in the mRNA sequence? A) DNA would not be…
A: An error in the sequence always results in the wrong aminoacid being produced. Hence option(c) is…
Q: 2. The precursor of each new nucleotide in a strand of DNA is a A) deoxynucleoside 5- diphosphate .…
A: They are the polymer of deoxynucleoside 5'-triphosphate. They are double-stranded which are wound…
Q: Why is it that every cell needs to contain the DNA for the entire body when only a few of its genes…
A: Aside from red blood cells and cornified cells, all other cells in the human body contain nuclear…
Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.
A: As you have not mentioned which part to answer, we are answering first three for you. If you want…
Q: List the DNA strand sequence complementary to the template strand.…
A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: 8. What is the function of polymerase? It adds nucleotides. It unwinds the original DNA strand. It…
A:
Q: 5. When can a mutation on the DNA cause shortening of the translation product? Give a specific…
A: Mutation is the phenomenon in which the DNA sequence is altered. This may occur spontaneously.…
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: 3. At which step would a mutation lead directly to the formation of an altered gene? DNA is copied…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino…
A: According to guidelines we have to answer the first question only. so please kindly post the…
6. What codons are found in the mRNA for the two mutated DNA?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3'* D A.) 5'-TAAGCATAAGGGCGCCACGTTG-3' O B.) 3- ATTCGTATTCCCGCGGTGCAAC-5' D C.) 3'-CAACGTGGCGCCCTTATGCTTA-5' D D.) 5'- CAACGTGGCGCCCTTATGCTTA-3' D E.) 3'-TAAGCATAAGGGCGCCACGTTG-5'Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.
- The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.g
- 8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
- 2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.