Upon the application of a botulinum toxin to a culture of freshly harvested neurons, a graduate student notices that activated neurons stopped releasing neurotransmitter upon activation. Performing a proteomic analysis she will not find which protein? a) synaptophysin b) synapsin

Q: What is the substrate of a histone acetyltransferase?

A: Substrate are molecule on which an enzyme acts.  Transcription is the process by which information…

Q: Based on studies, synaptotagmin is a crucial protein anchored to the vesicle and it is activated by…

A: Vesicular fusion and release of the vesicular content is very much important for the intracellular…

Q: 14) this is the serine protein kinase that when activated in a MPF complex that results in…

A: The cell cycle consists of the G1 phase, S phase, G2 phase, and mitotic phase, and is regulated by…

Q: Based on what you know about the structure of GPCRs, they must have: a)One internal start transfer…

A: Proteins destined for secretion outside the cell or lumen of an organelle are first targeted to the…

Q: Which of the following statements is true?   Question 9 options:   a)  Executioner caspases are…

A: Executioner caspases are a group of caspases that are responsible for the dismantling of the cell…

Q: a) What is the main structural and functional difference between microbial opsins and mammalian…

A: Both microbial opsins (type I) and mammalian opsins (type II) exhibit seven transmembrane domains in…

Q: 19. A 22-year-old man who was recently diagnosed with type 1 diabetes mellitus has learned to test…

A: Diabetes 1 is a chronic disorder. Due to this disorder the patient pancreas produces little or no…

Q: 4) The p53 protein normally involves a) DNA repair b) Cell cycle arrest c) Apoptosis d) All of the…

A: p53 is a gene that codes for a protein P53.

Q: Q: It has been found that some compounds, such as fungal toxins and some antibiotics, can inhibit…

A: Gene expression at the flow of information from DNA to RNA and then to proteins.

Q: 1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within…

A: Answer a)  If we do mutation at the c terminus skl tripeptide signal sequence then this protein will…

Q: Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c)…

A: Genes have a variety of different forms which are located at the same position or can be called…

Q: There are certain cells that are multinucleated (having more than one nucleus).  Which of the…

A: Cell division is the process by which the cells of a living organism multiply and increase in number…

Q: RNA are short-lived A) True B) False

A: Introduction: RNA is a single-stranded molecule in many of its biological roles and consists of a…

Q: Usually, bacteria only make tryptophan when tryptophan is absent or available in low concentration.…

A: Normally, bacteria regulate the synthesis of tryptophan through the trp operon. When tryptophan…

Q: protein via transmembrane protein translocation:

A: Free ribosome : These ribosomes are located in the cytosol and are able to move throughout the cell…

Q: he next four questions below refer to the following terms. Each term may be used once, core than…

A: Cell division is the process by which new cells are formed.

Q: 8.

A: In the given image, we are shown with a ribosome with large and small subunit assembled on mRNA and…

Q: Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking…

A: The question is all about the mutations that are defined as the abrupt changes in DNA sequences that…

Q: A fluorescent molecule of 2000 daltons is microinjected into a single cell of an epithelial layer.…

A: The question is asking us to identify the type of cell junction that allows the passage of a smaller…

Q: Match each one (they can be repeated): 1) Plasminogen- Plasmin 2) Pro-insulin- Insulin 3) CFTR…

A: Transcription and translation are two crucial mechanisms of all living cells. The enzyme  RNA…

Q: In some eukaryote organisms, myocytes are a type of stem cell that become Muscle cells. These cells…

A: The cell is the smallest, basic functional unit of life that is capable of independent existence.…

Q: a) b) c) You run away from your home because your parents forced you into medicine. You meet a drug…

A: Introduction :- The organic molecule acetylcholine serves as a neurotransmitter in the bodies and…

Q: A viral protein has a 20 amino acid amino acid chain consisting of the following primary structure:…

A: Amino acids are the building units of a protein. In viruses, protein is present in the capsid,…

Q: Write concisely on transcription and its place in protein synthesis

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: n ligand binds to a ligand gates ce closes e opens ns flow through gate is released

A: # Here I am answering only one question i.e. third . Please send questions one by one in the portal…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced…

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…

A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…

Q: ccording to the “Hawaiian Punch" principle, different compartments of the ecretory and endocytic…

A: According to the "Hawaiin punch" principle, multiple secretory and endocytic compartment pathways…

Q: In diseases such as Creutzfeldt-Jakob disease (CJD), a normal prion protein becomes infectious and…

A: Creutzfeldt-Jakob Disease:  Creutzfeldt-Jakob disease (CJD) is a neurodegenerative disease that…

Q: forskolin is a drug used by scientists to render adenylyl cyclase (AC) constitutively (always…

A: Coleus root contains forskolin. It is used to treat high blood pressure, angina, dry eye, and…

Q: What is the final result of mitosis in a human A) nearly genetically identical 2n somatic cells B)…

A: Mitosis: It is the process in which newly replicated chromosomes equally divided into two daughter…

Q: yclin-dependent kinases are present during   Question 4 options:   A)  M.   B)  G1.   C)  G2.…

A: Cyclin-dependent kinases (CDKs) play a central role in the regulation of the cell cycle, which is…

Q: please choose correct letter and explain a bit 1. The strongest way by which a protein can maintain…

A: (1).Answer--

Q: The cis golgi compartment ______. Options: A)  is a convenient place to store tools in small…

A: The Golgi apparatus is an organelle present in most eukaryotic cells. It is made up of…

Q: 18. The following is correct regarding calmodulin: A) It is a widespread calcium-responsive protein.…

A: Calmodulin It is a small, highly conserved intermediary protein. It constitutes about 148 amino…

Q: When ligand bin

A: 23) the correct answer is B) Animal cells respond to hormones produced by bacteria.   These hormones…

Q: Expression of a gene, in terms of greater accumulation of the protein it encodes, could be increased…

A: Often biomolecules like protein are produced in our body for any bodily functions. They are specific…

Q: The following questions refer to membrane protein isolation A) What is the difficulty when working…

A: Proteins are considered biological, organic polymers made of amino acids. Amino acids are connected…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: Which of the following is a possible consequence of a mutation that introduces a premature stop…

A: The stop codons are the specific genetic codon that do not codes any amino acids during the…

Q: Which of the following anticodons could be charged with Asparagine (Asn)? Question 23 options:…

A: An anticodon is a trinucleotide sequence complementary to that of a corresponding codon is a…

Q: The nucleus is the largest of the eukaryotic organelles and contains the genome of the organism.…

A: When viewing a cell picture, the nucleus is one of the most prominent features. The nucleus is found…

Q: Grisofulvin is an antifungal agent that affects: select the correct answer.  a) the chitin cell wall…

A: Griseofulvin is an antifungal drug which is used to treat several types of dermatophytosis…

Q: There are three different chitin synthase genes that control the chitin synthesis in Saccharomyces…

A: Saccharomyces cerevisiae and Chitin Synthesis --- Saccharomyces cerevisiae is a species of fungus…

Q: In a rare condition in which the immediate release of neurotransmitter is affected, a mutation in…

A: Ans: Neurotransmitters are the chemical messanger that released at the nerve endings and diffuse the…

Q: Which of the following are the common features for both adenylate cyclase and guanylyl cyclase? a)…

A: Proteins that function as biological catalysts are known as enzymes. Catalysts help to speed up…

Q: 4- Mitotic spindle is observed with: a) O Keratin filaments b) O Actin filaments C)O Cytoplasmic…

A: The growth and development of organisms are attributed to the unique ability of the cell to divide…

Q: What is the major difference between bacterial ribosomes and eukaryotic ribosomes that makes it…

A: Prokaryotes are the organisms that possess primitive cellular organization such as bacteria. They do…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.