Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure, hydrogen bonding, and strand polarity to write the sequence of each strand of DNA in a 5' to 3' direction. Left strand Right strand P- 0--H-N он CH N-H- N-H-0 CH N-H---O H-N CH, Left strand 5'- -3" Right strand 5'- -3'

10) In the diagram below: a) Label a phosphodiester linkage b) Label an N-glycosidic bond c) Label the 3' and 5' ends of the DNA strand d) Explain how you were able to identify these as the 3' and 5' ends 0₁P -CH₂ H₂C 0₂P-CH₂ ΝΗ 04P -CH₂ OH NH₂ NH₂

5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?

Produce the RNA strand that would be read from the DNA strand T -- A C -- G C -- G A -- A -- C -- G -- T -- T-- A -- ف في ن

Describe how replication makes copies of DNA.  Include the following: helicase polymerase primase and primer ligase leading strand lagging strand base pairing rule (a-t, c-g) nucelotide  nucleus semiconservative

Label the diagram to the corresponding letter

The type of DNA replication error illustrated in the diagram below is _______________________.

please dont give hand writting solution please

Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? TAAGTACATTACCCCG ACTTCTTCTCCGCTGC GACCGTATGCACGGTC GCCCACGCCAGTAGTG

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above