Chrome... x← CPort AmERNAFitDESEaedUse the codon table to determine which mRNA triplets code for the amino acid cysteine, Cys.Second mRNA baseCA(5'0fCOTONCOCOсb CUAOGCourse HU000UUUUUCUUAUUGCUUCUCCUGAUUAUAAUGSubmitGUUmylabmastering.pearson.com/?courseid=12411621&key=28... ☆GUCAUC lleUGGUGCUGUACAAGUU833PheLeuGUAn) GUGSelect all that apply.LeuViewMet orstartValUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCG160History Bookmarks Profiles Tab Window HelpQuickLaun XThrRequest AnswerSerProAlaUAUUACUAA StopUAG StopCAUCACCAACAGAAUAACAAAAAGGAUGACGAAGAGTyrHisGinAsnLysAspGluCGAUGUUGCUGA Stop AUGG Trp GCGUUCGCCGGAGUAGCAGAAGGGGUGGCGGAQuickLaury XGGGGCysArgSerArgGlyNOV6UThCAA baGUCGSo OcO O COTONRight to be(3¹XGn)M (no subje x☆出口口****31+UJO

Amino acids are the organic compounds that contain the amino, carboxyl, and the R-functional groups.…

Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Second mRNA base A F i r S t m ERNA DASC a осо COCON U G UUU UUC UUA UUG CUU CUC CUA (5' e A AUA- CUG AUU AUG GUU GUC Phe GUA n) GUG Leu Leu AUC lle ACC ACA Met or start UCU UCC Val UCA UCG CCU CCC CCA CCG ACU ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu UGU UGC UGA Stop A UGG Trp G CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG Cys Arg Ser Arg UT U THILO UR Gly A ERNA Joao Gn)

Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Second mRNA base A F i r S t m ERNA DASC a осо COCON U G UUU UUC UUA UUG CUU CUC CUA (5' e A AUA- CUG AUU AUG GUU GUC Phe GUA n) GUG Leu Leu AUC lle ACC ACA Met or start UCU UCC Val UCA UCG CCU CCC CCA CCG ACU ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu UGU UGC UGA Stop A UGG Trp G CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG Cys Arg Ser Arg UT U THILO UR Gly A ERNA Joao Gn)

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
Format Tools Table Window Help dit View Insert A A SU E D - Expression activities (1 Com Design Layout >> Tell me Sare Commen Insert Draw Font Paragraph Styles Dictate Sensitivity For each example, fill in the template strand DNA sequence, mRNA codons, tRNA anticodons, or amino acid sequence. If several sequences might work choose any one. Use the figures in your book for cross mapping. Answer the questions on the second page on a separate paper. 1. DNA MRNA AUG АCU A G C U G G G G G UAU U A C UUUUAG tRNA AA 2. DNA TAC C GC T C C G C C GT C GACA A T A C C ACT MRNA tRNA AA 3. DNA MRNA tRNA UA C CAC C Cc C GU AUG G CU A AU A UC G G G AA 4. DNA MRNA TRNA AA МЕТ ARG GLY PHE PHE МЕТ VAL GLY (STOP
mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked
mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…
Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…