Answered: True or false?: The CTD is responsible…

Name: True or false?: The CTD is responsible for mRNA-processing steps that
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.

Science

Biology

True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

A. Which two of the three modes of RNA processing are necessary to increase mRNA stability? B. Compare and contrast the ways in which each type of RNA processing you listed in part A increase mRNA stability. Be specific.
What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)
A. If a nascent MRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of nucleotide bases) was removed during mRNA processing, how many amino acids is expected to be in the protein that the matured mRNA codes for? [ Select ] Note: Include the start and stop codons in your analysis. B. If the first five codons of the MRNA is AUGAUGAUGAUGAUG, what is the amino acid sequence of the pentapeptide that the five codons will make? [ Select ]
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts. Be sure to include the name of the protein-ribonucleotide complex that’s involved.
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic bond connect the phosphate group to ribose. Before the mRNA can be used in translation, it has to undergo splicing, 3’ cap and 5' poly-A tail post-transcription modifications.
pre mRNA can be spliced in more than one way, permitting a single gene to produce multiple mRNAs encoding different polypeptides (true or false)
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. The 3D structure of a rRNA contains "stems" and "loops". siRNA is involved in the splicing of mRNA.
Each type of pre-mRNA processing has one or more important functions. Match each function with the appropriate type of processing. Addition of 5' cap Addition of poly(A) tail removes non-coding regions from pre-mRNA constructs multiple products from a single gene alters nucleotide sequence in exons Answer Bank assists in RNA splicing RNA splicing RNA editing assists mRNA in binding to the small ribosomal subunit stabilizes trailing end of mRNA facilitates transport of mRNA into the cytoplasm
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
pre-mRNA maturation to mRNA involves a guanosine nucleotide that is not part of the RNA polymer undergoing splicing. True False
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made