Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars would not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein
Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…
A: Transcription is the initial stage in gene expression, when information from a gene is used to build…
Q: Evaluate the following statements. Which one statement is false?
A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…
Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…
A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…
Q: Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T…
A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…
Q: Draw a simple schematic of a tRNA molecule showing its two "business" ends.
A: t-RNA is a type of RNA molecule that is clover leaf like in structure. It is known as transfer RNA.
Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…
A: Ribosomal RNA or rRNA is a ribozyme that catalyzes the synthesis of proteins. This non-coding RNA…
Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…
A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…
Q: NA contains the information that a cell uses to synthesize a particular protein. How do proteins…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…
A: Translation is process by which the cells produce protein from the information provided by the DNA.…
Q: Which would be worse for an organism? Briefly explain your answer. B. The spliceosome can no longer…
A: Cell is the basic and fundamental unit of life. Survibility of life depend upon individual cells…
Q: 44
A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.
Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…
A: Introduction :- t-rna (transfer RNA) which is used in translation i.e protien synthesis.Its…
Q: translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming…
A: Since you have posted a question with multi-sub parts, we will solve the first three sub-parts for…
Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: Where does the transcription of DNA into mRNA occur in eukaryotes? A. Nucleus B. tRNA C.…
A: The gene expression involves the transcription and translation of gene and mRNA (messenger…
Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…
A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…
Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…
A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…
Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…
A: To determine: In all biomolecules, which describes the relationship between structure and function…
Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…
A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…
Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…
A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Give
A: Introduction:- The central dogma of biological sciences explains how genetic information is…
Q: How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not…
A: Translation is a process which takes place after transcription, in which the genetic information…
Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…
A: The process of formation of Amino acids from mRNA molecule is known as translation.
Q: Ribosomes contain catalytic ________ molecules.
A: Answer - Option C - rRNA
Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…
Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain your…
A: All humans are made up of numerous cells. Cells are the basic building blocks of an organism. Cells…
Q: Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…
A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…
Q: You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important…
A: tRNA is a short nucleotide RNA chain with L-shaped structure. A tRNA molecule is required for…
Q: An American biochemist Erwin Chargaff discovered that in the cells of all organisms he studied, the…
A: Introduction :- All living things are made up of cells, which are the basic building blocks. There…
Q: The ribosome is needed for translation of mRNA
A: Protein synthesis is a fundamental molecular phenomenon that takes place in the cytosol. It occurs…
Q: Scientists wanted to determine what molecule held the 'gene'. If they did a study in which a cell…
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…
A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…
Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…
Q: What process is the P site in a ribosome most closely associated with? a. Binds the tRNA…
A: Ribosomes are complex cell organelles, which are composed of ribonucleic acid (RNA) and ribosomal…
Q: The relationship between the gene and the synthesis of a specific protein: Describe the steps in the…
A: Answer:- Relationship between gene and synthesis of specific protein:- there are many protein which…
Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…
A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…
Q: Which statement is true of the translocation phase of elongation during protein synthesis? a. The…
A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…
Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…
A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…
Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…
Q: This model represents protein synthesis since the TRNA is delivering amino acids to form a…
A: The two main steps involved in protein synthesis are: transcription and translation. These two…
Q: Which statement is not true about hsitone ? A-They are positively charged at biological pH B-Most…
A: The nucleosome is the basic structural unit of chromatin. This contains 8 histones in a bead and 1…
Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…
A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…
Q: how does eukaryotic ribosome find the mRNA to be translated? A. the sigma factor B. the…
A: the 5' cap
Treating a cell with a drug to stop tRNA from doing its job would mean what?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars woulf not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein.Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translationWhich of the following BEST describes the characteristics and function of siRNA? A. a short strand of RNA that can complement and inactivate a sequence of mRNA B. a short strand of RNA that can act as a transcription factor to initiate transcription C. a strand of DNA that can bind to and inactivate an mRNA sequence D. a tRNA that is not able to attach to a ribosome and therefore inhibits the process of translation
- How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not have a nucleus, the translation of mRNA occurs while it is being transcribed b. In prokaryotes, pre-mRNA translation before transcription occurs within the cell c.In prokaryotes, reverse trancriptase simultaneously translates and transcribes mRNAd.In prokaryotes, functional mRNA allows for translation to be skipped, and proteins are made during transcriptionA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this TRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O Č. The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome. vered MacBook Air 80 F3 D00 D00 F4 F2 F5 % & 23what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
- Which of the following is the function of transfer RNA? a.Makes up the structure of ribosomes b.Stores genetic information c.Carries the message that guides polypeptide assembly d.Delivers amino acids to ribosomesWhich of the following is the function of transfer RNA? A. Carries the message that guides polypeptide assembly B. Stores genetic information C. Makes up the structure of ribosomes D. Delivers amino acids to ribosomesWhat genetic material in a living cell which is single stranded involved in the coding of genes for protein synthesis? * 1 point a. DNA b. RNA C. mRNA d. tRNA
- A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.Which of the following statements are NOT true? A. Replication is the process of making DNA and takes place in the nucleus of prokaryotic cells. B. Translation produces a polypeptide that may require additional processing to become a functional protein C. Transcription starts at the promoter of eukaryotic cells and scans until reaches the start codon. D. Splicing results in exons being put together and introns being removed