Where does the transcription of DNA into mRNA occur in eukaryotes?   A. Nucleus   B. tRNA   C. Ribosomes   D. Cytoplasm

Q: What protein has the code 6JX7 in the protein data bank? protein A. membrane B. spike protein C.…

A: The Protein Data Bank (commonly referred to as PDB) is an open access database containing…

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: In order to isolate the DNA or RNA from the cells, what would be the first step? a. to block the…

A:

Q: Examine the diagram carefully, and then answer the question below. VII VII i iv vii VII This diagram…

A: DNA is genetic material which composed of 4 nucleotide ATGC and present in double helix form.

Q: What type of molecule contains the site where amino acids link together to make a polypeptide? a.…

A: Translation is a process of protein synthesis from an mRNA sequence. It occurs in the ribosomal…

Q: 3⁰ A 5 A GC G G A UA A/C UGU P Examine the tRNA above. Which codon on the mRNA strand codes for this…

A: The translation is the process by which polypeptide chain or protein is synthesized from the mRNA…

Q: What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c.…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA…

A: Option D is the correct answer

Q: Why was the cold ethanol added to the soap and salt mixture?

A: DNA - is Deoxy Ribo Nucleic acid is a hereditary material which contains all the genetic information…

Q: Which statement BEST DESCRIBES the genetic code?   A. There can only be one codon for multiple amino…

A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…

Q: What is the invariant region of nucleic acids? A. Sugar group B. Nitrogenous base C. Methylation D.…

A: Nucleotides are the building blocks of 2′-deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).…

Q: The presence of a ribosome in the cytoplasm is a characteristic of ?

A: All organisms are composed of one or more cells. The cell is the smallest unit having the properties…

Q: Which gene regulation event is ONLY present in prokaryotes?  a. transcription level of regulation…

A:

Q: What is a nucleosome? a. A region in the cell’s nucleus that contains euchromatin b. A region of…

A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…

Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation? A. 16S…

A: Ribosomes are small particles in cytoplasm associated with ER membrane. Ribosome is made up of…

Q: A virologist is trying to make a new antiretroviral drug to treat HIV. In order to do so with the…

A: Human immunodeficiency virus ( HIV ) is an infectious disease which is affecting the immune system…

Q: What is the first step in protein synthesis?

A: The Translation is the second part of the central dogma of molecular biology: RNA Protein : It is…

Q: What is the rate-limiting step in cytoskeletal filament assembly?   A. Nucleation   B. Extension…

A: Rate limiting step means the slowest step of cytoskeleton filament. actin filaments, microtubules,…

Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…

A: m RNA codes for proteins. This process is called translation.  mutation is change in the DNA…

Q: Given the sequence of the DNA template as GTCATG, what would be the sequence of the mRNA? a. CAGTAC…

A: Here are some of the points to consider the mRNA from DNA; 1. RNA Nucleotides: RNA differs from DNA…

Q: What is the main difference between prokaryotic and eukaryotic cells? A. The size of the cells B.…

A: Cells are the basic unit of survival.

Q: Which type of mutation produces the same protein despite a change in the DNA? A. nonsense B.…

A: The mutation is defined as an alteration or change in the nucleotide sequence of the organism's…

Q: How do stem cells become specialized to absorb nutrients from food as intestinal cells? O A. through…

A: The specialized human cells that can differentiate into any type of cell are called stem cells. the…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: Which molecule provides the energy for the assembly of new nucleotides into a DNA strand during DNA…

A: Nucleic acid are the biological macromolecules just like other macromolecule like proteins and…

Q: What is the role of the nucleolus?   A. produce DNA   B. produce lipids…

A: Solution :- Nucleolus  Is a structure in the nucleus and is primarily responsible for creating…

Q: What is the kind of protein that binds to DNA and changes the amount of transcription? A.…

A: Transcription is that the method by that the data during a strand of deoxyribonucleic acid is…

Q: What is protein synthesis? A. The process of building new organelles in the cell B. The process of…

A: Proteins are made up of amino acids. The amino acids are linked together by peptide bonds to form a…

Q: What class of enzymes catalyze the phosphorylation of amino acid residues in proteins?   a.…

A: Enzymes: These are natural biocatalysts that accelerate reaction to form products by decreasing the…

Q: What carries the genetic information in all cells? A. ribonucleic acid B. deoxyribonucleic acid…

A: According to the cell theory which was postulated by Theodor Schwann, living things are made up of…

Q: Chronic liver disease is common among HIV-infected patients, and is increasingly a cause of…

A: HIV stands for Human Immunodeficiency Virus. It is a positive strand enveloped RNA virus, belongs to…

Q: Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes?   A.…

A: ribosomal RNA one type of RNA molecule in cells that forms part of the protein-synthesizing…

Q: Which enzyme is responsible for the synthesis of pre-mRNA?   A. RNA polymerase I   B. RNA…

A: Correct option is  B.RNA polymerase II The nucleus uses the nucleotide sequence of DNA as a template…

Q: What is the chemical nature of membrane components that enable cells to move substances in and out…

A: The plasma membrane or cell membrane is a phospholipid bilayer. The most excepted model of the…

Q: At the end of which step does the amino acid chain fold into a three dimensional protein?   A.…

A: Mitosis is called as equational type of cell division because the daughter cells which are produced…

Q: What is the genetic information in DNA due to? A. composition of DNA in a gene B. specificity of…

A: DNA is made up of nucleotides. Each nucleotide is made up of deoxyribose sugar, nitrogenous bases…

Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…

A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…