The process by which point mutations cause slight changes in the spike proteins hemagglutinin and neuraminidase of the influenza virus is called O antigenic shift tranformation O transduction O antigenic drift

The process by which point mutations cause slight changes in the spike proteins hemagglutinin and neuraminidase of the influenza virus is called O antigenic shift tranformation O transduction O antigenic drift

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 4DID

See similar textbooks

Related questions

Q: Jenny works on a cow farm and has recently come down with a certain type of flu that has never been…

A: Flu disease is caused by virus in animals.

Q: What is the reason that you have to be immunized witha new influenza vaccine each year?a. the…

A: Immunity can be defined as the ability of an organism to fight against infections caused by a…

Q: CD4 is O The receptor protein on some immune cells that allows HIV to recognize its host cell The…

A: AIDS is most severe form of HIV infection.The transmission of HIV requires contact with a body fluid…

Q: Viral pandemics are often caused by antigenic shift antigenic drift antigenic fitness O antigenic…

A: The ultimate 4 many years have witnessed a number of the deadliest viral pandemics with some…

Q: The process by which non-viral DNA is brought into a bacterial cell by a phage is referred to as…

A: Bacteria are microscopic organisms that positioned in prokaryote as these are unicellular organisms.…

Q: Traditional vaccines may not work for COVID-19 because the antibodies produced in response to the…

A: The basic principle of vaccine manufacturing and its ability to produce an immune response is the…

Q: Clinical studies showed that zinc significantly shortens the duration of symptoms during rhinovirus.…

A: The common cold is caused by rhinovirus infections (rhinovirus implies "nose"). They can also induce…

Q: While a prophage genome is integrated into the host cell chromosome, it is O temperate. latent and…

A: Viruses are small infectious agents that only multiply inside live cells.

Q: HIV has a high mutation rate due to the imprecise opera-tion of its:(a) Viral membrane(b) CD4…

A: HIV (human immunodeficiency virus) is responsible for causing AIDS (acquired immune deficiency…

Q: In HIV infection, reverse transcriptase Multiple Choice O makes DNA from viral RNA. makes RNA from…

A: HIV refers to the infection that is caused by the human immunodeficiency virus (HIV). This virus is…

Q: Complete the following analogy, based on tre comparisons made in the reading: "Why our flu vaccines…

A: Answer Human immune response

Q: Complete the following analogy, based on the comparisons made in the read "Why our flu vaccines…

A: Human immune response As evolution of flu virus is fast and how body respond to it.

Q: What happens to individual Vaccinia viral particles that do not possess the genes necessary to…

A: As we know that viruses are simple, noncellular entities consist of either DNA or RNA enclosed in a…

Q: Distinguish between antigenic drift and antigenic shift ininfluenza.

A: Influenza virus is a RNA virus that contains negative sense single stranded RNA as its genetic…

Q: Typically associated with Influenza O the antigenic drift is a major antigenic change due to gene…

A: Influenza is a virus which cause infection in humans. It is commonly known as "the flu". The…

Q: Why might you expect an influenza epidemic to be more severe following an antigenic shift in the…

A: Influenza viruses are constantly changing and mutating. These changes are categorized as…

Q: two viruses infect the same cell. This results in the production of new viruses that contain genetic…

A: Infection refers to the entry of microorganisms into a host body followed by multiplication of the…

Q: The high degree of mutation in HIV, the accumulation of variant viruses, and the development of…

A: The viruses having RNA as their main genetic material are known as the retrovirus. These viruses…

Q: Somo mutations, of changes in the sequenco of DNA, do not have any offect on the characteristios of…

A: According to the question, some mutations or changes in the sequence of DNA do not have any effect…

Q: emdesivir is an antiviral drug that is currently being used to treat COVID-19. Which part of the…

A: Ans: Remdesivir is an antiviral medicine that originally first tested against the Ebola virus in…

Q: A viral protein binding to the cellular receptor induces which of the following: O a.A…

A: A viral protein binding to cellular receptor induces which of the following:

Q: Superinfection immunity refers to: O the inability of a temperate phage to infect any bacterial…

A: Superinfection immunity is often linked to lysogeny, and it appears to be a result of the same…

Q: Which of the following statements is TRUE? a. An individual with a BO genotype is homozygous for B…

A: Of the given options, option B is the most appropriate answer for the given question.

Q: Some virulent bacteria become avirulent, or at least much less virulent, when a bacteriophage is…

A: Virulence is the ability of an organism to infect a host and result in a disease.

Q: The process in which recipient bacterial cells acquire genes from cell-to-cell contact with other…

A: Transfer of genes in prokaryotes occurs through horizontal gene transfer mechanisms like…

Q: The process by which point mutations cause slight changes in the spike proteins hemagglutinin and…

A: The surface proteins hemagglutinin and neuraminidase are the two antigens that matter in the…

Q: omparing influenza viruses and COVID-19 pandemic coronavirus, both these viruses can incre enetic…

A: Genetic diversity can be increased through mutation, sexual recombination, random mating and random…

Q: The type of viral replication in which a bacteriophage rapidly assembles more viral particles, and…

A: Given: Need to find which cycle is responsible for assembling more viral particle and kills the…

Q: Which TWO statements regarding viral infection are TRUE? O Viral particles may be shed during the…

A: Viral infection Proliferation of a harmful virus within the body. Viruses cannot reproduce without…

Q: The evolution of influenza virus that causes relatively mild and limited disease epidemics is…

A: The influenza virus is a negative-sense single-stranded RNA that causes severe infection to the…

Q: Which receptors of the influenza virus are responsible for binding tothe host cell?a. hemagglutinin…

A: Influenza virus belongs to class V that contains minus single stranded segmented RNA as their…

Q: each complementation group in the blanks provided below. (Some of the blanks may remain empty.) Cd e…

A: Complementation test is a test in genetics. It is also known as cis trans test. It is used to find…

Q: Virology:Influenza virus is able to cause repeated infections by evading immune responses by using…

A: Viruses can infect people. However, viruses infect a huge variety of creatures, so you may discover…

Q: Which of the following statement is false regarding the emergence of new viral strains? Reverse…

A: The following statement is false regarding the emergence of new viral strains-

Q: This type of adaptive immunity in prokaryotes is built through acquisition and integration of short…

A: Introduction The adaptive immune system, is a subsystem of the immune system made up of specialized,…

Q: In the fall of 2019 the CDC announced that there had been a mutation in one of the influenza strains…

A: The genome of the viruses are very susceptible of mutation that help them adaptation in the new and…

Q: Lysogenic bacteriophages can Become dormant in host cells Transfer new genes to bacteria Integrate…

A: Answer is (E) All of the above Lysogenic bacteriophage can become dormant in host cells transfer…

Q: The article "Why our flu vaccines can't keep up" mentions the concept of herd immunity. Look up what…

A: Herd immunity is also known as 'population immunity' or 'community immunity'. Herd immunity occurs…

Q: People with the CCR5Δ32 mutation of a T-cell surface protein can be exposed to some strains of HIV-1…

A: T-cells are the cells of immune system which are affected by the HIV-1 virus. CCR5Δ32 mutation is a…

Q: Due to the lack of any antiviral for a newly emergent virus, blood harvested from individuals who…

A: Sera or blood serum is the clear liquid devoid of clotting factors. Some individuals infected by…

Q: The SARS-CoV-2 virus has a genome made of O a. RNA O b. DNA O c. carbohydrates O d. lipid O e.…

A: Answer is Option a. SARS-CoV-2 has a genome made of RNA.

Q: The process in which recipient bacterial cells acquire genes from cell-to-cell contact with other…

A: Gene transfer is the process of insertion of unrelated DNA into cells. There are three mechanisms of…

Q: What is eas9 used fer Aaturally by baeteria? O Eitting viral BNA FEBIACIAE B3EteFial gehes Senes…

A: Ans - Cutting viral DNA

Q: One strain of influenza can infect multiple hosts including humans pigs and birds. What is a…

A: Antigenic shift is a process by which two or more different strains of a virus, or strains of two of…

Q: What's the term to describe a mutant viral protein, apart from any genetic material, that can cause…

A: Introduction :- Viruses are submicroscopic infectious agents that can only reproduce inside live…

Q: ss on the method of generating the vaccir e: The immune system will produce specific The immune…

A: 1st option

Q: What is the vaccine delivery system used in the Moderna's COVID-19 vaccine? O Fentanyl patches O…

A: Moderna COVID-19 vaccine is messenger RNA vaccine. It is also called mRNA vaccine.

Q: Concerning HIV, which of these statements is false? O HIV is a retrovirus O HIV can be cured today O…

A: HIV or Human Immunodeficiency Virus is a type of retrovirus that causes the disease AIDS or Acquired…

Q: Influenza virus has a segmented (-) strand RNA genome, and each segment has its own nucleoprotein…

A: a. Influenza virus belongs to Myxovirus which is an enveloped RNA virus. b. Other types of viruses…

Q: Which of these happen(s) in the case of antigenic shift in influenza A?a. single mutations in…

A: Antigenic drift is a more slow genetic change resulting from mutations, while antigenic shift is a…

Concept explainers

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.

Question

The process by which point mutations cause slight changes in the spike proteins hemagglutinin and
neuraminidase of the influenza virus is called
antigenic shift
tranformation
transduction
antigenic drift

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cell
For the following E.coli genotype trpR- trpP+ trpO+ trpE- / trpR- trpP+ trpO+ trpE+ the production of the first enzyme (trpE) in the tryptophan operon is zero repressible constitutive inducible
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
In the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.
Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
Use the blanks on the left hand side to put the following statements in order (use numbers or letters to designate the order). All of the statements refer to the diauxic (sequential) growth of a bacterium on the carbon substrates glucose and lactose (see textbook Fig 4.11 on diauxic growth). Remember, the lac operon contains the genes necessary for the lactose catabolism. The glucose substrate is completely consumed, at which time the repressor protein on the lac operon unbinds from the DNA molecule. The lactose substrate is catabolized by the active B-galactosidase enzyme. Glucose, as the preferred carbon substrate, is first consumed by catabolic enzymes that are constitutive (always present). After completion of translation, the B-galactosidase enzyme undergoes folding to form into an active enzyme that can breakdown lactose into its constituent monosaccharides. The messenger RNA code from the lac operon is translated by ribosomal RNAS to form lac-related enzymes, such as…
The process in which the two-dimensional structure of RNA from the L region of an operon can either prevent or allow transcription of the structural genes is called _____________. Group of answer choices Activation Co-repression Induction Attenuation Repression
The streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1
Regarding the tryptophan operon in bacteria, in the presence of tryptophan, tryptophan binds to the Group of answer choices Operon Operator Repressor Promoter RNA polymerase
When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________. tryptophan inactivates the repressor protein translation termination of the trp operon is likely the trp operon is transcribed at relatively high levels the ribosomes stall during translation of the attenuator region transcription termination at the attenuator region is likely
Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7
Consider this strain of E. coli with lac operon alleles: IS pt o* z* y+ /T p* oCz- Y+ In a written response, briefly explain if beta-galactosidase AND permease will be expressed, and if so, will they be inducible or constitutive.