Q: In E. coli, induction in the lac operon and repression in the trp operon are both examples of a.…
A: Transcription, translation, post-transcription and post-translation. The process in which the gene…
Q: The TRP operon functions by attenuation. Briefly explain how attenuation works and why it is…
A: Trp operon or the tryptophan operon is a group of genes that are responsible for tryptophan enzymes.…
Q: A researcher was trying to determine whether two molecules (molecule A and molecule B) were co-…
A: CoRepressor - The function of the corepressor is to induce transcriptional silencing or to repress…
Q: In the lac and trp operons, the repressors are said to be “allosteric molecules” because…
A: Operons are basically the cluster of genes that can be transcribed together to give a messenger RNA…
Q: Maltose utilization in E. coli requires the proteins encoded by genes in three different operons.…
A: It is given that the maltose utilisation in E.coli requires the proteins which are encoded by genes…
Q: In the lac operon, the product of structural gene lacZ is capable of ________. producing zinc…
A: The lac operon is an operon, or gathering of genes with one promoter. The genes in the operon encode…
Q: Operon X produces three enzymes that convert Compound A to Compound B. The R gene makes the…
A: Gene expression is given on the basis of RNA. It is a process through which there is turning on of…
Q: E. coli has five genes that code for enzymes that make tryptophan. These genes are regulated by a…
A: When a group of related genes exist under the control of a single promoter, it is referred to as an…
Q: The trp operon in E. coli encodes enzymes essential for the biosynthesis of tryptophan. In the…
A: trp operon is a repressor operon found in E. coli bacteria, which consists of a group of genes that…
Q: According to the operon model, for the synthesis of an inducible enzyme to occur, the end-product…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: ttenuator control of the Trp operon what is the correct option from the choices below? involves a…
A: The trp operon, found in E. coli bacteria, is a group of genes that encode biosynthetic enzymes for…
Q: Regulation of the E. coli trp operon by attenuation requires the trp repressor protein. prevents…
A: An operon is a function unit of DNA containing a set of genes including structural gene, a…
Q: Components necessary for regulating the /trp/ operon do NOT include
A: Answer - Option E - CAP protein
Q: Complete the diagrams below to reflect the proteins and any relevant cofactors (e.g. -…
A: Exergonic reactions have negative free energy change Where are endergonic reactions have positive…
Q: The polycistronic Histidine Operon in E. coli encodes all of the proteins necessary for the…
A: An operon is a gene unit of bacterial system whose transcription is positively and negatively…
Q: A bacterial operon is responsible for the production of the biosyntheticenzymes needed to make the…
A: An operon is a group of genes that are all transcribed by the same promoter. Negative control means…
Q: An E. coli cell acquires a mutation in the gene that encodes CAP. The mutation affects the…
A: The transcription is a process through which information in the DNA molecule is transcribed into…
Q: Expression of the operon ultimately results in the synthesis of the repressor (Q) and co-repressor…
A: A repressor is a protein that turns off the expression of one or more genes. The repressor protein…
Q: The lac operon in E. coli bacteria codes for proteins that break down (digest) the disaccharide…
A: The lac operon is expressed at its highest levels when there is lactose but no glucose (Option C is…
Q: Bacteria with a lac phenotype are unable to use lactose because of some defect in expressing the…
A: Answers - 1) False 2) True 3) True There are 3 structural genes in lac operon - lac Z, lac Y and…
Q: Like the lac operon, the hexose operon is controlled by a separate regulatory protein under the…
A: Hexose operon is the set of structural genes, regulatory genes, promoter and operator sequence in…
Q: In a bacterial operon, the active repressor bind to the A. promoter. B. terminator. C.…
A: The operon concept can be defined as a DNA containing a set of genes that are transcribed basically…
Q: You have cells that are mutant in CAP protein such that it cannot bind to CAMP. For these mutant…
A: Cap protein- In solution, the catabolite activator protein (CAP, also known as cAMP receptor…
Q: Maltose utilization in E. coli requires the proteins encoded by genes in three different operons.…
A: The process of maltose utilization in E.coli requires the proteins encoded by genes in three…
Q: ac operon. Drag the listed molecules to their corresponding bin. Reset Help ONPG IPTG X-Gal…
A: ONPG - beta-galactosidase cleaves this molecule to form a visible yellow product. Explaination: The…
Q: The tryptophan (trp) operon is a repressible system. This means the genes are normally expressed,…
A: Introduction : Amino acids are essential for the survival of bacteria like E. coli. There are a…
Q: The tryptophan operon is regulated by two methods. Describe in detail the regulation of the operon…
A: Genes are the functional unit of heredity. Operons are a group of genes under a single promoter. The…
Q: When referring to attenuation in the regulation of the trp operon it would be safe to say that, when…
A: Attenuation is a regulatory mechanism that is employed in bacterial operons to guarantee that…
Q: The trp operon is: **(for additional information review the CogBooks Module, answer explained on…
A: Negative inducible operons is a method wherever the active regulator macromolecule binds to the…
Q: Match the term with its description. cAMP Allows lactose to enter the cell and product of the…
A: Cyclic Adenosine monophosphate is a second messenger which is necessary for various biological…
Q: Explain how the following conditions will affect the regulation of the operon. (3 pts) Low cAMP…
A: Lac operon is a mechanism seen in the E coli that enables the proper metabolism in its body. The…
Q: Assuming that the level of glucose is low, a mutation in the repressor associated with the lac…
A: The lac operon which is also known as lactose operon is a set of genes that are specific for uptake…
Q: Which of the following is true about the Lac operon? Group of answer choices An operon with a…
A: Operon is the cluster of genes found in DNA. It consists os regulatory gene, structural gene,…
Q: The tryptophan operon of E. coli represents an example of a gene regulatory system which is: a…
A: The trp operon, found in the bacterium Escherichia coli is a group of genes that encode biosynthetic…
Q: For each description, state if the gene expression will increase (1), decrease (2) or remain the…
A: The transcription is a process through which information in the DNA molecule is transcribed into…
Q: B. A researcher was trying to determine whether two molecules (A and B) were corepressors or…
A: A- Molecule A is corepressors Molecule B is inducer In molecule A ,It resemble corepressor…
Q: What is the role of catabolite activator protein (CAP) in the lactose operon of E. coli?
A: Lac operon Lac operon is a group of protein that code for enzyme β-galactosidase. The function of…
Q: Like the lac operon, the hexose operon is controlled by a separate regulatory protein under the…
A: Hexose operon is the segment of DNA which includes regulatory gene, structural gene, promoter and…
Q: The operator of the lactose operon in E. Coli is located: between the promoter and the…
A: The lac operon in Ecoli is concerned with the digestion process of the lactose sugar. For this gene…
Q: Theara operon is an inducible operon that controls the production of the sugar arabinose. When…
A: An operon is a group of genes that are transcribed together and are under the influence of a single…
Q: Like the lac operon, the hexose operon is controlled by a separate regulatory protein under the…
A: The operons are regions in DNA which have a cluster of related genes and these function as a unit.…
Q: The tryptophan operon is a repressible operon that is A. transcribed only when glucose is present…
A: The tryptophan operon is a repressible operon that is - B. not transcribed whenever tryptophan is…
Q: A. The gene that regulates the production of the Lacl protein is found further upstream of the lac…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: In the lac operon, the lacZ gene codes for an enzyme called ____________, which catalyze the…
A: 1st blank: beta-galactosidase 2nd blank: Lactose
Q: Discuss the regulation of the tryptophan operon. How does this story change under the two…
A: Introduction: The trp operon is a collection of genes found in E. coli bacteria that code for…
Q: The blob operon produces enzymes that convert compound A into compound B. The operon is controlled…
A: Operon is a term used for the functional unit of the DNA that contains the cluster of genes which…
Q: consider the fec operon of Staphylococcus madeupiddis, which encodes an iron citrate uptake system.…
A: The fec operon is responsible for regulating the expression of iron in the cytoplasm of cell.
Q: In the tryptophan operon, tryptophan is considered a Group of answer choices coactivator inducer an…
A: Step 1 Jacob and Monad (1961) from their study in bacterial genetics proposed that genetic material…
Q: A mutation at the operator prevents the regulator protein from binding.What effect will this…
A: Inducible operon has proteins that bind to repress or activate transcription. It depends on the…
Step by step
Solved in 2 steps with 1 images
- One of the main lessons of this chapter is that severalbacterial genes are often transcribed from a singlepromoter into a large multigene (polycistronic) transcript. The region of DNA containing the set of genesthat are cotranscribed, along with all of the regulatoryelements that control the expression of these genes, iscalled an operon.a. Which of the mechanisms in the following listcould explain differences in the levels of themRNAs for different operons?b. Which of the mechanisms in the following listcould explain differences in the levels of theprotein products of different genes in the sameoperon?i. Different promoters might have different DNAsequences.ii. Different promoters might be recognized bydifferent types of RNA polymerase.iii. The secondary structures of mRNAs might differ so as to influence the rate at which they aredegraded by ribonucleases.PROBLEMSProblems 575a. Why did the mating with a nonlysogenic recipientresult in phage growth and release, but the infectionof a…The activator (V protein) that is present in the bacterial cell is normally phosphorylated, but only binds to the A site in the operon when it is not phosphorylated. What operon-independent mechanism can regulate the binding of (and also ultimately regulates the removal of) protein V to the A site? Describe this binding/removal mechanism in detail – useappropriateterminologythatwasdiscussedinlecture. Aspartofyouransweraboutthisactivatorproteinbindingto (and then detaching from) the A site of the operon, be sure to address what are the results of this type of control in terms of function of the operon.The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
- Many amino acid biosynthetic operons under attenuationcontrol are also under negative control. Considering that theenvironment of a bacterium can be highly dynamic, whatadvantage could be conferred by having attenuation as asecond layer of control?The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.Consider this strain of E. coli with lac operon alleles: IS pt o* z* y+ /T p* oCz- Y+ In a written response, briefly explain if beta-galactosidase AND permease will be expressed, and if so, will they be inducible or constitutive.
- The promoter of an operon is the site to which RNApolymerase binds to begin transcription. Certain basechanges in the promoter result in a mutant site towhich RNA polymerase cannot bind. Would you expect mutations in the promoter that prevent binding ofRNA polymerase to act in trans on another copy ofthe operon on a plasmid in the cell, or only in cis onthe copy immediately adjacent to the mutated site?Resection of a bacterial chromosome in which genes for the enzymes of of a particular metabolic pathway are clusteredtogether in a functional complex under coordinate control is called operon activator promotor repressor operatorAs shown a genetic switch that controls the choicebetween the lytic and lysogenic cycles of phage λ. What is agenetic switch? Compare the roles of a genetic switch and a simpleoperator site (like the one found in the lac operon) in generegulation.
- The figure at the beginning of this chapter showsthe binding of both a Lac repressor tetramer and aCRP-cAMP complex to the regulatory region of thelac operon.a. What is the key feature of a regulatory protein suchas the Lac repressor or CRP that allows it to regulate specifically the genes or operons it is supposedto control?b. On the figure, show the positions of the followingcomponents: (i) A Lac repressor monomer; (ii) a Lacrepressor dimer; (iii) all four DNA binding domains ofthe Lac repressor tetramer; (iv) a single helix-turnhelix motif; (v) the o1 part and either the o2 or o3 partsof the lac operator (assume the operon would be transcribed from right to left on the figure); (vi) themultimerization domains of the four Lac repressormonomers; (vii) an inducer-interacting domain; (viii)the CRP-cAMP complex; and (ix) a DNA loop.c. What is the physical basis for the formation of theDNA loop shown in the figure?d. On the figure, show the position of two axes ofsymmetry in the sequence…You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH, andhupG. Diagram the mRNA for this operon, showingthe location of the 5′ and 3′ ends, all open readingframes, translational start sites, stop codons, transcription termination signals, and any regions thatmight be in the mRNA but do not serve any of thesefunctions.For the following E.coli genotype trpR- trpP+ trpO+ trpE- / trpR- trpP+ trpO+ trpE+ the production of the first enzyme (trpE) in the tryptophan operon is zero repressible constitutive inducible