the leftside. Briefly, explain how the semiconservative mode of DNA replication is supported by their experimental results and what they may have seen if the replication modes were conservative or dispersive.

Pen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting the population living along the Limpopo River Basin. Scientists working on the elucidation of more details about the virus have finally characterized it as a DNA virus (containing DNA as a genetic material and not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of the viral genome responsible for viral replication, is shown with the following sequence: DNA sequence: 5'-CTACACTITATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3' A. "Transcribe" and form an RNA transcript based on the DNA sequence. B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. C. What is/are the characteristic feature/s of the resulting…

Please ASAP. Thank you

Restriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. PCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kb

Biological Macromolecules Understanding that DNA replication is semiconservative -pil... 0/5 Julianna The coding (sense) strands of two complete (double-stranded) DNA molecules have the base sequences shown in the table below. Two replication experiments are done with each molecule: 1. In Experiment #1, samples of each DNA molecule are incubated with radioactive adenine, along with appropriate replication enzymes, ATP, adenine, thymine, and cytosine. Experiment #1 is stopped when each DNA molecule has replicated once. 2. In Experiment # 2, all the DNA molecules from #1 are purified, and then incubated with with a similar reaction mixture is used this time. Experiment #2 is stopped when each DNA molecule has replicated one more time. - ? except non-radioactive adenine olo Predict the percentage of DNA in each sample that is radioactive after each experiment. Round your answers to the nearest percent. DNA coding strand sequence 5'- TGGCTG-3' 5'- ACGGGC-3' % of DNA radioactive after...…

5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.

Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

Plasmid Mapping (what is it? why is it important?).

Please ASAP. Thank you

transformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)