13. For DNA, agarose is used as the main chemical to make the gel. What is the purpose of the buffer used on the gel?

21. The difference between a nucleoside and nucleotide is:  Group of answer choices 1. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has a sugar with a nitrogenous base and phosphate groups attached to the sugar. 2. Nucleotides contain deoxyribose sugar and nucleosides contain ribose sugar 3. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication 4. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has a sugar with a nitrogenous base and phosphate groups attached to the sugar.

DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA molecule below to show what the two semi-conserved strands would look like.                  A G T A C C G G G C A A A C T G C A T T G T G                  I  I  I   I  I  I  I  I   I  I  I  I  I   I  I  I  I  I   I  I  I   I  I  I  I  I                     T C A T G G C C C G T T T G A C G T A A C A C                   old strand   A G T A C C G G G C A A A C T G C A T T G T G          new strand:            new strand:           old strand   T C A T G G C C C G T T T G A C G T A A C A C   Gene Expression: 2. Use your DNA strand to construct a part of a messenger RNA molecule.          DNA            A G T A C C G G G C A A A C T G C A T T G T G            mRNA:

The following gel was obtained using the Sanger method. What is the DNA sequence and what does the arrow represent?

A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gell following electrophoresis. Label each fragment with its corresponding letter. Each band on the gel will be the same width, equal to the width of the well at the top of the gell. These should be in one lane.  Do smaller or larger (pb) fragments migrate the furthest? Why?

1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’   a. 3’ – CGCATAGC – 5’   b. 3’ – CGCAUAGC – 5’   c. 3’ – CGUCGAGC – 5’   d. 3’ – CGUCGAGC – 5’   e. None of the above b) Which one of the following statements is true?   a. The lac repressor and catabolite activator protein are both controlled by allosteric binding   b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor   c. The lac repressor is inhibited by lactose through competitive inhibition   d. β-galactosidase will hydrolyze galactose to form glucose and lactose   e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity

You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm

Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage

Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?

In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________. beta chain pleated sheet alpha helix double helix