Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?

A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3 undergoes DNA replication in vitro in the presence of all four nucleotides plus an amount of dideoxyadenosine triphosphate sufficient to compete for incorporation with deoxyadenosine triphosphate.   How many and what DNA fragments are expected?

The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH

Would my anwser be correct for this question?

The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections.       Human; Human   EBV; Human   EBV; EBV   Human; EBV

Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.

In both leading and lagging strand synthesis, DNA replication always proceeds in a certain direction. What direction is this? Explain how oligonucleotide primers in the Polymerase Chain Reaction work (PCR)

If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.