Pen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting the population living along the Limpopo River Basin. Scientists working on the elucidation of more details about the virus have finally characterized it as a DNA virus (containing DNA as a genetic material and not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of the viral genome responsible for viral replication, is shown with the following sequence: DNA sequence: 5'-CTACACTTTATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3' A. "Transcribe" and form an RNA transcript based on the DNA sequence. B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. C. What is/are the characteristic feature/s of the resulting polypeptide based on the viral DNA sequence given?

Please number the bullets

Quick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.

Multiple Matching. Match the term with its description.___________nucleic acid probe___________nontemplate strand___________template strand___________reverse transcriptase___________Taq polymerase ___________RNAi___________primer___________restriction endonucleasea. enzyme that transcribes RNA into DNAb. complementary strand that blocks mRNA expressionc. the nontranslated strand of DNA or RNAd. enzyme that snips DNA at palindromese. oligonucleotide that initiates the PCRf. strand of nucleic acid that is transcribed or translatedg. thermostable enzyme for synthesizing DNAh. oligonucleotide used in hybridization