The genome of SARS-CoV-2 is a single-stranded sense (coding) mRNA that is translated into many functional and structural proteins required for the replication and assembly of the virus, including the famous spike protein. Comparing the sequence to that of SARS-CoV-1 and a number of other beta-coronaviruses reveals that by far the most conserved sequence within the entire ~30,000 nucleotide mRNA genome is located in the 3'-UTR, near the end of the message. The difference between that sequence in the original isolates of SARS-CoV-2 is only 1 in 50 nucleotides. What is the most likely explanation for this high degree of sequence conservation? The mRNA in this region encodes for a protein with a required proteus site to make the mature viral coat protein that participates in membrane fusion, without which the virus cannot propagate. The mRNA in this region encodes for an essential protein whose fold cannot tolerate amino acid substitutions. The mRNA in this region is part of a required splice site O The mRNA in this region encodes a transcription termination signal. O The mRNA in this region encodes the ribosomal entry and/or start sites, which cannot change their sequence appreciably. The mRNA forms an essential 3-D structure in this region required for viral propagation

The genome of SARS-CoV-2 is a single-stranded sense (coding) mRNA that is translated into many functional and structural proteins required for the replication and assembly of the virus, including the famous spike protein. Comparing the sequence to that of SARS-CoV-1 and a number of other beta-coronaviruses reveals that by far the most conserved sequence within the entire ~30,000 nucleotide mRNA genome is located in the 3'-UTR, near the end of the message. The difference between that sequence in the original isolates of SARS-CoV-2 is only 1 in 50 nucleotides. What is the most likely explanation for this high degree of sequence conservation? The mRNA in this region encodes for a protein with a required proteus site to make the mature viral coat protein that participates in membrane fusion, without which the virus cannot propagate. The mRNA in this region encodes for an essential protein whose fold cannot tolerate amino acid substitutions. The mRNA in this region is part of a required splice site O The mRNA in this region encodes a transcription termination signal. O The mRNA in this region encodes the ribosomal entry and/or start sites, which cannot change their sequence appreciably. The mRNA forms an essential 3-D structure in this region required for viral propagation

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The bacteriophage genome consists primarily of genes encodingproteins that make up the head, collar and tail, and tail fibers When these genes are transcribed following phage infection, howare these proteins synthesized, since the phage genome lacksgenes essential to ribosome structure?
Virologists are closely monitoring the evolution of an avian virus that occasionally jump species. This virus is known to adhere to sialic acids on human skin. Sialic acids are a family of nine-carbon sugar compounds that bear significant negative charges. Which of the following mutations in the virus is the most alarming? (A) A deletion of a Lys residue on the viral spike protein. (B) A substitution of a Lys residue by an Asp residue on the viral spike protein. (C) A deletion of an Asp residue on the viral spike protein. (D) A substitution of a Asp residue by a Lys residue on the viral spike protein. Chemically speaking, protonation of the carbonyl oxygen in a peptide bond makes the carbonyl carbon more vulnerable to nucleophilic attacks. Which of the following structures in chymotrypsin implements this strategy? (A) Asp 102 (B) Oxyanion hole (C) Ser 195 (D) His 57
Explain the structural activity between trans-ferulic acid and the NS2B-NS3 protease in the DENV-2 strain? Please refer to the specific conserved domains affected in the NS2B-NS3 Protease by trans ferric acid and how trans ferric acid can prevent viral replication by inhibiting the activity of the NS2B-NS3 protease in DENV-2.
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Explain in Biochemistry concepts like folding, and amino acids, enzyme reaction of MPro enzyme in connection to its role with the COVID-19 virus. asap please.
Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expression to promote viral replication.For example, herpes simplex virus-1 (HSV-1) expresses aprotein called ICP0, which is necessary for successful viral infectionand replication within the host. Lutz et al. (2017. Viruses9: 210) showed that ICP0 can act as a ubiquitin ligase and targetthe redundant transcriptional repressors ZEB1 and ZEB2,which leads to upregulation of the miR-183 cluster (a set of threemiRNAs transcribed from the same locus). Speculate on how miR-183 cluster upregulation may benefitthe virus.
Replication of both strands of DNA in adenoviruses occurs ina continuous (leading) fashion. How can this happen withoutviolating the rule that DNA synthesis always occurs in a5′ S 3′ direction?
Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expression to promote viral replication.For example, herpes simplex virus-1 (HSV-1) expresses aprotein called ICP0, which is necessary for successful viral infectionand replication within the host. Lutz et al. (2017. Viruses9: 210) showed that ICP0 can act as a ubiquitin ligase and targetthe redundant transcriptional repressors ZEB1 and ZEB2,which leads to upregulation of the miR-183 cluster (a set of threemiRNAs transcribed from the same locus). How may ICP0 expression in a host cell lead to upregulationof the miR-183 cluster?
Given this viral mRNA, which model represents the correct (+)ssRNA genome from which it was made? mRNA AUAUUUGCG... O O (+) AUAUUUGCG. (+) UAUAAACGC_ (+) AUAUUUGCG. (+) UAUAAACGC
The palm domain of poliovirus RdRP contains a GDD motif. Explain why changing D (Asp) in the GDD to alanine produces an inactive polymerase that can no longer copy RNA templates. (changing protein fold is not enough) G= Glutamic acid D: Aspartic acid
Here is a partof the mRNA sequence of the spike glycoprotein of the SARS Covid-19 virus, starting with the start codon. A deletion was found in 6 bp (underlined). How will this change affect the polypeptide sequence? >S_protein AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUA
As stated in the text, bacteriophages have been discovered with the following base substitutions in their DNA: (a) dUMP completely substituting for 'TMP (b) 5-hydroxymethyl-dUMP completely substituting for d'TMP (c) 5-methyl-dCMP completely substituting for dCMP For any one of these cases, formulate a set of virus-coded enzyme activities that could lead to the observed substitution. Write a balanced equation for each reaction you propose.