The following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments.

Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…

A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…

Q: what would the net charge on the tetra peptide of sequence ala-lys-glu-ser at ph 7.2 what would it…

A: Amino acids are the building blocks of proteins or peptides formed of chiral carbon having four…

Q: Calculate the pI for the following tri-peptide: Glu-Arg-Lys

A: pI or isoelectric point is the pH at which a peptide or molecule is electrically neutral. The pH of…

Q: the peptide (written N-terminal to C-terminal) represented by Ala-Ser-Ala-Tyr the same as the…

A: Ans. Yes, the polypeptide chain of amino acid will be Similarly in structure and function whether it…

Q: Sir Bong wanted to determine the a amino acide sequence og BONG. The summary of the analyses…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: How do you think incorporating b-homoserine into a peptide would affect the structure and/or…

A: Homoserine, is the product of a cyanogen bromide cleavage of a peptide by degradation of methionine.…

Q: Write the structure of each of the following peptides. Start with the N-terminal and the COO- on the…

A: Peptides are the sequence of amino acids that are joined through formation of peptide bond. The…

Q: A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of…

A: A tridecapeptide is an oligopeptide having thirteen amino acid residues.

Q: Digestion of a peptide with trypsin generates two smaller peptide products: methionine-glycine and…

A: pepsin is a serine protease that cleaves the bond present in the C-terminal of amino acids Lysine…

Q: A pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to…

A: *Electrophoresis is a technique used to separate genetic materials like DNA and RNA and  protein…

Q: A hexapeptide of unknown sequence was isolated from an amphibian skin then sequenced. The following…

A: Hi! Thanks for your question but the data are insufficient for solving the queries. I am writing…

Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…

A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S1…

A: Serine proteases are proteolytic enzymes that cleave peptide bonds. They are hydrolases that use a…

Q: How many small peptide fragments will result if you treat the peptide…

A: Peptide is the molecule containing 2 to 50 amino acid residue covalently joined together with the…

Q: You are in the process of determining theamino acid sequence of a protein and must reconcile…

A: In the first trial, the protein has glycine at the amino terminal while asparagine at the carboxyl…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A).…

A: Peptide includes a short chain of amino acids that are connected to each other by peptide bond. A…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: The primary structure of the protein refers to the amino acid sequence in the peptide. The amino…

Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…

A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…

Q: Identify and briefly describe the different PEGylation strategies you can use to PEGylate this…

A: PEGylation refers to the process where polyethylene glycol polymer is chemically added to a protein…

Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…

A: Only twenty of the available amino acids are often present in proteins among all the possible amino…

Q: you were given an unknown peptide. Explain in detail how you would determine the amino acid sequence…

A: The amino acids that form the protein are mostly L forms. The carboxyl group of amino acids in the…

Q: How many different sequences of mRNA could encode a peptide with the sequence…

A: mRNA is decoded by the cells by reading their nucleotides in groups of three known as codons where…

Q: How do you think incorporating a-methylserine into a peptide would affect the structure and/or…

A: proteins are made up of amino acids . amino acid polarity and peptide struture depends upon the side…

Q: The following data describe the catalysis of cleavage of peptide bonds in small peptides by the…

A: The enzymes that cleave the peptide bonds are known as proteases. There are many types of proteases…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: A peptide digested with trypsin produced the following three fragments: C, ASFPK, GGRWDGK The same…

A: Proteolysis or protein digestion is the process of breaking down of proteins using enzymes known as…

Q: Determine the identity of the N-terminal amino acid after reconstructing the intact protein. Why is…

A: Introduction:- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: How do chemical synthesis of protein that contain native serine residues by the reaction of…

A: Amide-forming ligation reactions allow the chemical synthesis of proteins by the union of…

Q: Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide…

A: The amino acids that form peptide chains can be either polar/non-polar, charged/uncharged,…

Q: What method could be used to make an immobilised library of 6 different peptides, all differing by…

A: INTRODUCTION   Peptide-based molecular probes identified by bacteriophage (phage) display technology…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: You are trying to determine the PTMs on your protein of interest, so you set up a mass spectrometry…

A: The modification of proteins after its biosynthesis is called post-translational modification (PTM).…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Which amino acid sequence will be generated?  5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'

A: During translation mRNA is translated into amino acid sequence, by the help of various enzymes, tRNA…

Q: A peptide with 12 amino acids has the composition (not sequence) Asp 2Cys 2Glu 2Leu 2Ser 2Tyr Val.…

A: Proteins are polypeptide sequences comprised of amino acids. Arrangement of amino acids in different…

Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…

A: Chymotrypsin is an endonuclease that works on the carboxyl-terminal end of the amino acids like…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…

A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…

Q: Which of these mutations would you predict to be most detrimental?  Explain your answer.  (Refer to…

A:

Q: Draw a peptide for cys-asn- pro-gly (Using the same format in picture)

A: Proteins are the building blocks of life. Proteins are made up of amino acids. Amino acids when they…

Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…

A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…

Q: The folding of intrinsically disordered proteins is prevented by the presence of Ser, Lys, and Glu…

A: The protein property depends on the amino acid property.

Q: PLEASE DONT COPY IN GOOGLE OR HERE ON BARTLEBY. Salt bridges are more commonly formed compared to…

A: Introduction: The fundamental driving force behind the folding of a protein is energy. A folded…