A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…

A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…

Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…

A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…

Q: You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of…

A: DNA sequences are transcribed into mRNA sequence, which acts as codons for the amino acid sequence.…

Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…

A: Central dogma  is the process in which RNA is produced from the DNA (transcription) and amino acid…

Q: Why is the peptide formation always presented/read from N-terminal to C-terminal?

A: Introduction:  Amino acids are joined together by a condensation reaction between carboxylic and…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: A hexapeptide of unknown sequence was isolated from an amphibian skin then sequenced. The following…

A: Hi! Thanks for your question but the data are insufficient for solving the queries. I am writing…

Q: Which of the sequences below do you think would most likely be found in an intrinsically disordered…

A: Intrinsically disordered proteins (IDPs) are those that do not have a proper three-dimensional…

Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…

A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…

Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

Q: You are trying to isolate a protein you don't know much about, so you decide to use a gel column…

A: Introduction :-  Chromatography is a biophysical technique which is used to separate or isolate the…

Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…

A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: ou have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100…

A: Natural selection is a theory that states that organisms evolved by changing their heritable traits…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…

A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…

Q: For a protein-DNA binding reaction with ΔH = 0, sketch the van’t Hoff plot, label both axes.

A: Van't hoff equation gives the relationship between equilibrium constant, temperature, and enthalpy…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: What are the sequences of all the possible tripeptides that contain the amino acids, serine, leucine…

A: The polypeptide is made up of amino acid residues, which are joined by the peptide bond.

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'?

A: In the polymerase chain reaction (PCR), a primer is a short, single-stranded DNA sequence. A pair of…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…

A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…

Q: Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain…

A: The condition represented in the sequence alignment is amino acid replacement. In amino-acid…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: 1. For each of the sequences given below, list what type of secondary structural element, if any is…

A: Proteins are found in four structures namely:  Primary which is a linear sequence of amino acids.…

Q: What method could be used to make an immobilised library of 6 different peptides, all differing by…

A: INTRODUCTION   Peptide-based molecular probes identified by bacteriophage (phage) display technology…

Q: Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor…

A: It's an example of ONE GENE ONE ENZYME HYPOTHESIS By beadle and Tatum. Arginine is an alpha - amino…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: In reversible terminator sequencing, how would the sequencing process be affected if the…

A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…

Q: You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin…

A: Trypsin cleave the peptide on the carboxy side of arginine and lysine residues. Cyanogen bromide…

Q: You have sequenced the genome of the bacterium Salmonella typhimurium and a protein that is 100…

A: The protein sequence is dependent on the DNA sequence. When DNA is transcribed, it forms mRNA and…

Q: What is a motif? Why is it useful for computer programs to identifyfunctional motifs within amino…

A: Bioinformatics has permitted molecular biologists to store and analyze a large amount of data…

Q: what does the Hexa protein domain depict? (in relation with tay sachs disease)

A: Beta-hexoaminidase A is an enzyme that is present in the lysozyme. It breaks down a fatty substance…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   What human disease has been connected to this gene?…

A: The given sequence  CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Q: What is the meaning of the statement “The code is redundant but not ambiguous?”.

A: Base-pair substitution, deletion, or addition constitutes a mutation in a gene. The effect of such…

Q: Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?

A: The proteins or peptides that are inserted into the plasma membrane are called integral membrane…