Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Ala-Leu-Arg-Gly-Met-Val-Arg-Lys-Ala O 2 9,

What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. How could you have an insertion or deletion mutation that does not cause a frame shift?

Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?

UCAGUCAGUOPODOTO E GFL A Alanine GU STOP Tyrosine A Stop C STOP V A Valine GU Cysteine G Stop G Tryplophan Arginine G A C A U Leucine Serine A UG Lysine Proline Asparagine GACUGACU H. MIR START Glycine Serine Leucine Glutamic Phenyl acid Aspartie acid Histidine RSK Glutamine Arginine Methionine Isoleucine Threonine

nyiaial liio C cysteine stop phenylalanine serine tyrosine A leucine serine stop tryptophan arginine arginine arginine arginine leucine serine stop leucine proline histidine U histidine proline proline proline leucine C A glutamine glutamine asparagine asparagine lysine lysine aspartate aspartate glutamate glutamate leucine leucine isoleucine threonine serine isoleucine threonine serine C A arginine arginine glycine glycine glycine glycine isoleucine threonine A methionine threonine valine alanine valine alanine G A valine alanine valine alanine G What would be the sequence of amino acids based on the codons found on the following MRNA? 5' AUGCCCUAUAGGUGA3' leucine - Histidine - Arginine - Valine - Cysteine-Arginine | O Tyrosine - Glysine - Isoleucine - Serine - Methionine-Stop | O Methionine - Proline - Tyrosine - Arginine-Stop O Methionine - Proline -Proline - Valine-Stop |

Answer the following questions based on the structure of the following peptide and the information in the attached table of enzyme activities. M-F-V-W-E-Q-A-P-S-P-L Subjecting this peptide to trypsin would result in OA Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro-Lys Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro-Leu OB. Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro-Leu OC. D. Met-Phe-Val-Trp-Glu-Gin-Arg and Pro-Ser-Pro-Lys O E. Met-Phe-Val-Trp and Glu-Gin-Arg-Pro-Ser-Pro-Leu

sars-coV-2 spike protien what is the isoelectric point of this peptide? VGIYLQKTSDHRPEFALAMN

How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…

Draw the peptide provided in its most protonated form. (Upload your answer.) Arg - Cys - Asp - Val

Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.