The following sequence is part of a globular protein. Predict the secondarystructure in this region.cRRPVVLMAACLRPVVFITYGDGGTYYHWYH c

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: Which peptide sequence is most likely to be found within the inner core of a globular protein?…

A: Biochemistry is a branch of science that deals with the study of chemical processes related to the…

Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…

A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: How is the peptide shown named (give each 3-letter name for the amino acids present)? Whichamino…

A: The peptide is made up of amino acid. The sequence of amino acid in this peptide is N - Val-Phe-Trp-…

Q: Translate the given amino acid sequence into one-letter code.…

A: Genetic codons are long enough to be taken in account in research purposes. So as for such, some…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: Subjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P OA Lys and…

A: Trypsin is an enzyme that break peptide bond has a specific site of cleavage.

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: Protein: Hemoglobin Circle and underline each codon, amino acid sequence, make a mutation of the 3rd…

A: The hemoglobin protein, which carries oxygen throughout the body, is represented by the provided…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: A peptide with 19 amino acid residues was digested with trypsin and generated the following…

A: The one letter code for different amino acids are :-  G - glycine I - isoleucine  R - arginine  S -…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA…

A: In this problem, the normal sequence of a protein is given, and three different protein sequences…

Q: Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11…

A: Hi! Thanks for your question. As you have posted multiple sub-parts, we are answering only the first…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: Identify the type of mutation present in the CDS and discuss the implications on the protein.

A: Mutations are random alteration in the DNA structure which leads to mis-reading of Information on…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: Polypeptides with the ER Signal Sequence (MMSFVSLLLVGILFTATEAEQLTKCEVFQ <- one-letter amino acid…

A: Proteins are synthesized in the cytosol in a process called translation. RNA polymerase and other…

Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids.   Question 2 options:…

A:

Q: 8. The amino acid sequence for the beginning of the globular protein myoglobin is:…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Define upstream processing when producing a protein and list two examples. Cite it.

A: A bioprocess is a method for producing desirable products having medicinal importance with the help…

Q: The folding of some protein was monitored as a function of the time it takes for the protein to…

A: The proteins can be modified by different modifications and this modification can affect the…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: Which of the following peptide sequences is most likely to be found in a hydrophobic pocket of the…

A: Introduction: The correct choice is option 2. AVGF

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: A mutation is a change in a DNA sequence. It can result from DNA copying mistakes made during cell…

Q: You are in the process of determining theamino acid sequence of a peptide. After trypsin digestion…

A: An amino acid is an organic molecule that is made up of a basic amino group, an acidic carboxyl…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Lactose Permease is roughly 45 kDa in size. Approximately how many nucleotides in length is the…

A: Lactose permease is a membrane protein serving as a transport system for lactose into the E. coli…

Q: You have digested a small protein with two different proteases, each protease acting on the protein…

A: A peptide bond is an amide linkage formed between two molecules where an α-carboxyl group of one…

Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln

A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…

Q: Below is the DNA sequence of a gene, what is the protein sequence?…

A: Proteins are biomolecules composed of monomers called "amino acids" that are adjoined by per tidal…

Q: Translate the following amino acid sequence into one-letter code:…

A: The unique one-letter code was developed for easy and fast recognition of amino acids. Each of the…

Process Flow Diagram

A process flow diagram is a representation of various components, how they are arranged, and in what manner or sequence they work in correspondence to each other. It is a graphical way of representing a process.