Given below is the mRNA sequence that encodes the amino acids of a protein.  Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the  protein sequence as SINGLE letter amino acids. mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…

A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…

A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: Write a possible mRNA sequence that could code for each peptide. Note: Reference the Genetic code…

A: To provide the mRNA sequence for each of the given amino acid peptide, we will be using the Genetic…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…

A: The genetic material of the cell contains various genes that code for various proteins. This happens…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Identify if the statement is correct or incorrect, "rRNA serves as template for the synthesis of…

A: During translation, protein is formed. A segment of DNA carries the code required for specific…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…

A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Q: TAG, TA, and TGA are stop codor

A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…

A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…