Given below is the mRNA sequence that encodes the amino acids of a protein.  Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the  protein sequence as SINGLE letter amino acids. mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-

Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'

For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G

Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA

Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5¹-UUCCCAAAGUAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs by substitution of the 12th nucleotide with cytidine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and nonsense.

Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG

Read instrxutions and complete MRNA CODON TABLE.

Read the images attached before answering the following question. Explain the meaning of the numbers and letter in the chromosomal location for gene A.

Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MRNA sequence below: UAACUAAGGAUGUAGUUAUG