GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT

Q: Define ribonuclease

A: Enzymes are mostly proteinaceous structures. But there are exceptions, some RNA molecules also act…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: How is tRNA involved in protein synthesis? How genetic code helps

A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…

Q: Which type of RNA has the least amount of secondary structure? Explain

A: Ribonucleic acid (RNA) is considered an important biological macromolecule present in all cells to…

Q: Define transfer RNA (tRNA)

A: Ribonucleic acid [RNA] is single-stranded nucleic acids that are composed of a nitrogenous base, a…

Q: Name the process by which the information on DNA is copied into an RNA molecule.

A: Nucleic acids store and transmit hereditary information. There are two types of nucleic acids:…

Q: Define ribonucleic acid (RNA)

A: Nucleic acids are large biomolecules that are composed of nucleotides and mainly made up of three…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Explain the subunits of ribosomal RNA

A: Ribosomal ribonucleic acid or rRNA is a kind of non coding DNA which is major component of ribosome…

Q: Describe the structure and function of tRNA

A: BASIC INFORMATION  RNA  It stands for Ribonucleic acid. They are of three types;  messenger RNA…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Use the codon chart to translate this RNA sequence into amino acids. *Hint* Pay attention to start…

A: When we have to translate a genetic sequence into amino acid we use stand table known as codon chart…

Q: describe insertion sequences

A: DNA is the information centre for most organisms. DNA is made up of a long chain of nucleotide base…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: write the full form of RNA

A: Nucleic acids are large biomolecules or biopolymers. It is essential to all known forms of life. The…

Q: Define Sense codon  as they apply to the genetic code

A: Sense codons are those codons which specify amino acids at the time of protein synthesis…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: Describe the function of the different types of RNA.

A: RNA  is an acronym for ribonucleic acid. RNA consists of  nitrogenous base, phosphoric acid, ribose…

Q: Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is…

A: DNA and RNA are the main components that carry genetic information from one generation to another…

Q: Provide the DNA sequencce  (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Explain synthesis of RNA in a flow chart- from pre-mRNA to final mature RNA.

A: The RNA transcript first made in a eukaryotic cell is known as pre mRNA. It must be processed into…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: Describe  the relationship between

A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar.  The mRNA…

Q: Explain the relationship between RNA structure andfunction.

A: Conceptual Introduction RNA plays a crucial in Central dogma by transferring the genetic information…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.