GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT

From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

Use the chart here to answer the following question. Second Base in Codon U A G UAU]. Tyr UACJ Ser UAA Stop UGA Stop A UGU Cys UGC) UUU] UUC Phe UUA), Leu UCU) UCC UCA UCG) U UUGJ UAG Stop UGG Trp G CCU |CAU] His CACJH Pro CAA), CUU CGU CGC Arg U CỤC Leu CỦA ССС CCA CGA CGG CAG Gln AAU] CUG CCG G AGU] AUU) AUC lle A AUA, AUG Met or ACG Start GUU ACU) ACC ACA U AGC Ser AGA Arg AGG Thr AAC Asn AAA] Lys AAGJ GCU GỤC GUA GUG GAU Asp GACJ Ala GAA), Glu GAGJ GGU GGC GGA GGG GCC GCA C Gly Val A GCG) G List the three amino acids coded for in the following genetic code. Write your answer in the following format (xxx, xxx, xxx) using three letter abbreviations for the amino acids. AAUGACGGU First Base in Codon Third Base in Codon

Put the function of mRNA is blank   select one: