The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? 00000 I lane 1 lane 2 lane 3 lane 4 lane 5 TATAA Mutation A. Deletion of indicated 2 nucleotides AUG TSS Mutation B. Deletion of 150 nucleotides N 1 2 3 4 5 UAA Mutation C. 3 nucleotides changed

Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’   What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!

This is a list of molecular changes that could happen during DNA replication, transcription, mRNA processing, or translation. For each, determine whether or not the change will be passed down through generations of cells after it occurs. Explain your answer.  C->G point mutation in the DNA of a coding region of a gene A->T point mutation in the noncoding region of a gene An error in transcription changes the mRNA sequence such that what was an amino acid-coding codon in the DNA sequence is now a stop codon in the mRNA sequence. An error in translation causes the amino acid alanine (nonpolar) to be replaced by the amino acid glutamic acid (polar and negatively charged).

A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’   what type of mutation is this?   Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?

The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? --4 ТАТАА AUG UAA Only known regulatory region TSS Mutation B: Mutation C. A: 5-base 20 nucleotides 3 nucleotides deletion deleted changed N 1 2 3 4 5

Protein levels and mRNA levels for a particualr gene don’t always match.  For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved.  A.    what is one mechanism by which changes in mRNA levels are not always matched by changes in the protein product of that mRNA?

The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to muscle defects during development. Using what you know about how mutations can affect transcriptional and post-transcriptional regulation, match the results shown on the Northern (mature mRNA) to the mutations shown. The N lane shows the size and amount expected for non-mutated myosin mRNA. All samples were loaded at the top (-) side of the gel. Part 1. Which lane or lanes on the gel could be the result of mutation A? ТАТА AUG UAA Only known regulatory region TSS Mutation B: Mutation C. 3 nucleotides 20 nucleotides deleted A: 5-base deletion changed 1 2 4 5 lane 1 lane 2 lane 3 lane 4 lane 5 OOO0O

Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.

A diagram of a gene is shown below. Normally, exons 1, 2, and 3 are present in the mature mRNA. (shown in attatched image) A mutation occurred at the 5’ splice site of exon 1 as shown by the star such that the spliceosome cannot bind to this location during mRNA processing of the pre-mRNA into the mature mRNA. Which of the following is/are a possible result of this mutation? (select all that apply) a)The pre-mRNA transcribed from this gene sequence will be longer than normal. b)The protein translated from this mRNA will be a different length than the normal protein. c)The mature mRNA will be longer. d)The mature mRNA will be shorter.

Haemochromatosis is a recessive disorder caused by mutations in the HFE gene. The disorder can be the result of nonfunctional HFE protein, or from very low levels (expression) of the HFE protein. Below is a northern blot gel showing the amount and size of HFE mRNA for a person who does not have haemochromatosis (WT). The mRNA was loaded at the top of the gel. WT A B C D Position the bands on the gel shown in each question as directed. Part 1 Tom has a mutation which changes the sequence of an enhancer region adjacent to the TATAA box for this gene. Position Tom's band in Lane A. WT A B 00