Suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide change, the mRNA produced from this gene has a slightly different sequence compared to the mRNA produced from the unaltered/non-mutated gene. However, the resulting protein produced from both of these gene versions is exactly the same. This type of mutation would be classified as a missense mutation. degenerate mutation. silent mutation. nonsense mutation. frameshift mutation.

Q: But are all mutations bad? Is there a type of mutation that may provide an advantageous to an…

A: Mutations are the changes in the DNA sequences which may occur due to error in DNA copying or any…

Q: Which type of mutation best describes a change in a non-coding region of the genome?

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Explain why a point mutation does not necessarily change the oriignal amino acid sequence.  Explain…

A: A mutation refers to the alteration in the sequence of nucleotides in an organism’s DNA…

Q: Define mutation. Then describe the three basic types of mutation (substitutions, insertions, and…

A: A mutation is an alteration in the DNA sequence that mainly arises during the replication of DNA or…

Q: point mutations that affect the amino acid sequence of a protein include, frameshift mutations,…

A: ANSWER : Absolutely, let's delve into missense mutations and how they can influence protein…

Q: Mutation a change in the DNA Point mutations - when a single nitrogen base is deleted, inserted or…

A: The key information we need for understanding mutation is the specific base pairings. The specific…

Q: You suspect a protein that is being expressed has been affected by a mutation.  When you examine the…

A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: Which one is NOT a possible cause of mutation? O extreme temperature O bacterial infection O…

A: A mutation is a random change that occurs in a DNA sequence. The causes of DNA mutation include (a)…

Q: What type of mutation occurred at mutation #2 and does it cause a frameshift? Sequence Original…

A: Mutation is a change in nucleotide sequence of DNA. There are various types of mutations. Point…

Q: Which of the following mutations in a gene will most likely have the greatest impact on the…

A: Mutation is any change in structures or functional aspects of gene (genome ) which may occur due to…

Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Which mutation would most likely cause the greatest impact

A: A mutation occurs when the DNA sequence modifies. Mutations can occur as a result of errors in DNA…

Q: Part A. When a mutation arises, it can have three possible consequences for the individual:…

A: A negative, or deleterious, mutation reduces the organism's fitness. A beneficial or advantageous…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: The word mutation is generally considered to be negative. However, is there a positive side to…

A: MUTATION:- a mutation refers to a change in a DNA sequence.it can result from Dna copying mistakes…

Q: Point mutations arise more commonly than other types of mutations. -True or False

A: Point mutation is a mutation in which one base pair in the DNA sequence get altered.

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Which of the following point mutations would properly be defined as a transition mutation?  the…

A: The substitution mutations of DNA are of two types: Transitions and Transversions. Transitions are…

Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…

A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…

Q: Mutations that affect organisms are those that involve exons. True or False. Defend your answer and…

A: Introduction :  A complete gene consists of Exon and intron . Esona are sequence of DNA or RNA…

Q: Explain why point mutations may be silent, but frameshift mutations rarely are.

A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: In humans, sickle-cell anemia and hemophilia represent which type of mutations?     Loss of…

A: Mutations are of different types. Mutations are change in the sequence of DNA which may cause the…

Q: A frameshift mutation could not result in a a nonsense mutation. O silent mutation. Oa hypomorphic…

A: Mutations can be classified as: Point mutations = that change only one nucleotide in a codon is…

Q: None

A: Neutral mutations depend on the degeneracy of the genetic code.Neutral mutations are frequently the…

Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW  Why Phosphate bond is important in DNA or RNA…

A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…

Q: Which of the following is true in regards to mutagenesis? Mutations occur because of a selective…

A: The process of altering genetic information of an organism through mutation is referred to as…

Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…

A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: What is mutations definition of mutations? types of mutations proper explanation and diagram

A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…

Q: Compare and contrast nonsense mutations, silent mutations, and missense mutations including the…

A: Muttations are the phenomenon in which one or more base pairs are affected or change in the…

Q: A set of nucleotides in an original DNA strand reads: TAC GCG AAT Transcribe this short DNA…

A: Gene is the sequence of nucleotides in a DNA. It encodes a protein.

Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…

A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…

Q: Can you briefly explain each types of mutation (difference, unique fact, etc) ? Please don’t just…

A: Mutations are the changes in the genome resulting in the synthesis of different products. These…

Q: loss of function mutation

A: Sorry for the inconvenience. As per bartleby  guidelines we should not give the answers for 2…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: make a point mutation and Frameshift mutation

A: point mutation, change within a gene in which one base pair in the DNA sequence is altered. Point…

Q: Insertion or removal of one or two nucleotide base pairs in a protein coding region of DNA usually…

A: Frameshift mutation is defined as insertion or deletion of a number of nucleotides that is not in…

Q: Mutagens, when introduced to the body can always cause cancer. Is this statement true? Select the…

A: Any agent that can cause mutation in the genetic material are called as the mutagen. Mutagen may be…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.