Suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide change, the mRNA produced from this gene has a slightly different sequence compared to the mRNA produced from the unaltered/non-mutated gene. However, the resulting protein produced from both of these gene versions is exactly the same. This type of mutation would be classified as a missense mutation. degenerate mutation. silent mutation. nonsense mutation. frameshift mutation.

Q: Which type of mutation is simulated in the following example?   Wild type: THE ONE BIG FLY HAD…

A: The mutation simulated is point mutation.

Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…

A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: Suppose that a mutation resulted in a tapeworm that did not have hooks. Assuming this tapeworm was a…

A: Tapeworms are a parasite that is segmented and grows in length up to 70 centimeters. The bodily…

Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Which mutation would most likely cause the greatest impact

A: A mutation occurs when the DNA sequence modifies. Mutations can occur as a result of errors in DNA…

Q: Part A. When a mutation arises, it can have three possible consequences for the individual:…

A: A negative, or deleterious, mutation reduces the organism's fitness. A beneficial or advantageous…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Need to find which of the following mutation is happened in protein to express in wrong cell

Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…

A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…

Q: Mutations in the CFTR gene can cause a disease that affects the entire organism. Arrange these…

A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…

Q: Gene mutations can be classified in two major ways: (1) hereditary or germline mutations that are…

A: Gene is the sequence of nucleotides that encode a particular protein.

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Fill in the Table  Broad Topic: Specific Topic: What is known: Experimental Question:…

A: This work explores single-cell level gene expression mistakes in Bacillus subtilis. The study looks…

Q: What is a nonsense mutation?     A change from a codon for one amino acid to a codon for another…

A: mutation has different types according to their deletion or duplication of specific codons. The…

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: Mutation rates vary for genes. All of the following are factors that influence the mutation rate of…

A: The mutation is one of the significant mechanism which directly affects the survival of the organism…

Q: In humans, sickle-cell anemia and hemophilia represent which type of mutations?     Loss of…

A: Mutations are of different types. Mutations are change in the sequence of DNA which may cause the…

Q: Which of the following is/are a transition mutation(s)? (select any that apply) A to T   A to G   C…

A: Point mutations refer to the change of a single nucleotide. These can be single base substitution or…

Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…

A: The protein translation is the process of the formation of proteins from the mRNA formed from the…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: What is mutations definition of mutations? types of mutations proper explanation and diagram

A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…

Q: As a hobby you propagate a population of worms. You notice that one worm is now clear instead of…

A: Deletions are mutations in which a section of DNA is lost, or deleted. Since protein-coding DNA is…

Q: Discuss    how    mutations    may    arise    in    DNA,    and    the    potential    consequences…

A: Mutations are the changes in the nucleotide sequence of DNA and it arises at the time of DNA…

Q: What is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of…

A: Hello! Since you have posted multiple questions, we are answering only the first two questions.…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…

A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…

Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…

A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…

Q: Why are RNA viruses more likely to mutate than those that have genomes made of DNA? 2.What would…

A: Viruses generally have genetic material, either DNA or RNA inside a coat of proteins and…

Q: make a point mutation and Frameshift mutation

A: point mutation, change within a gene in which one base pair in the DNA sequence is altered. Point…

Q: rue or False? Mutations are never introduced during normal cellular processes in the eukaryotic…

A: Mutation- is the change in the nucleotide sequence of a short region of a genome . Many mutations…

Q: You are working in the lab with two known carcinogens found in cigarette smoke: Benzo(a)pyren (BaP)…

A: Carcinogens are substances or agents that have the ability to cause cancer by altering or damaging…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: As bacterial DNA replicates, a point mutation occurs in which an A nucleotide is changed to a C…

A: DNA is a helically twisted double chain polydeoxyribonucleotide macromolecule. The sequence of…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: Unlike in prokaryotic cells,  transcription and translation in eukaryotic cells... Group of answer…

A: DNA is a polynucleotide strand that consists of a large number of nucleotides. Nucleotides consist…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.