Mutations in the CFTR gene can cause a disease that affects the entire organism. Arrange these levels of biological organization in order (1-5) of increasing complexity to explain how a mutation in a molecule can result in dysfunction of the entire organism.

A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately, after this mutation, the protein is no longer secreted, but it is now localized to the cytosol and not the nucleus. Briefly answer the two questions below: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoning

Identify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]

Below is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.