Q: SCREENED BACTERICIDE LAMPS SHOULD BE INSTALLED IN 1. premises for pharmacy visitors 2.…
A: the answer is 4 Screened bactericidal lamps should be installed in distillation rooms and…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: The polar bear is a hyper-carnivorous bear whose native range lies within the Arctic Circle,…
Q: What types of evidence support the hypothesis that land plants descended from the group of green…
A:
Q: Complete the following statements to describe eating disorders. Individuals with an irrational fear…
A: Anorexia Nervosa: Anorexia nervosa, or just anorexia, is an eating illness marked by an abnormally…
Q: Energy is released reactants AG <0 products Time This graph shows an reaction. Gibbs Free Energy
A: This graph showing exothermic reaction.
Q: need help with microbiology/2010 1. Describe where the following items should be discarded: a)…
A: There are two types of bacteria: Gram-negative Gram-positive
Q: Propose specific types of mutations in the gene forthe regulatory subunit of cyclic-AMP-dependent…
A: PKA is a protein kinase that is activated by the second messenger cyclic AMP (cAMP). It regulates…
Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…
A: The appendix is a small finger-shaped organ that is located beneath the right abdomen. It has no…
Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…
A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…
Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…
A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…
Q: TOTAL MICROBIAL NUMBER OF DRINKING WATER (ACCORDING TO SANPIN REQUIREMENTS 2.1.4.1074-01) IN 100 ML…
A: A sufficient, clean, and safe drinking water supply must be provided for varied consumers as a…
Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…
A: Introduction The Pasteur effect:- It is an inhibiting effect of oxygen on the fermentation process,…
Q: how will the body maintain homeostasis in osmoregulation
A: Homeostasis refers to an animal's capacity to manage different physiological cycles to keep the…
Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…
A: Under anaerobic conditions, yeast uses its nutrition to produce energy. Yeast cells cannot undergo…
Q: Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…
A: Answer given in step 2 onwards. As per our guideline i can answer only 3 subpart only but I gave you…
Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…
A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…
Q: In the following cases of disputed paternity, determine the probable father by writing Father 1 or…
A:
Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…
A: Under anaerobic conditions, yeast uses its nutrition to produce energy. Yeast cells cannot undergo…
Q: 5. Which of the following can increase mean arterial pressure (MAP) in an individual? I. II. III.…
A: Given : Mean arterial pressure (MAP) is defined as the average arterial pressure that happens…
Q: What is the function of outer hair cells? How does the function of these cells differ compared to…
A: INTRODUCTION Inner hair cell They are sensory receptors gives acoustic information to brain. Outer…
Q: First food chain Second food chain Trophic level Organism Trophic level Organism
A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…
Q: ROSE OF WIND 1. graphic image of the frequency of wind direction in the area 2. wind speed, shown…
A: A wind rose is a graphical tool that meteorologists employ to show how wind speed and direction are…
Q: 9. Which of the following is/are the sign(s) of renal malfunction? I. Renal clearance of creatinine…
A: Urinary system is a type of body system which generally involved in formation of urine and it's…
Q: 2. Why is oxygen when unbound to any other material can be toxic to life? 3. What is the role of…
A: 2. By its proclivity for univalent reduction, which results in the production of reactive oxygen…
Q: GENERAL EXCHANGE VENTILATION (MORE AIR ENTERS THAN IS REMOVED) IS NEEDED FOR GENERAL EXCHANGE OF…
A: Exaust Ventilation is used for 4). Preventing propagation of pollutants throughout the room.
Q: SAMPLES THE DEVICE 1. rheometer 2. catatermeter 3. anemometer 4. Krotov's apparatus 5. luximeter
A: INTRODUCTION The indoor environment is extremely complicated. Both outdoor and indoor air contains…
Q: Given the results of our calculations of inclusive fitness for male pied kingfishers (Ceryle rudis)…
A: The pied kingfisher (Ceryle rudis) is an African and Asian water kingfisher. It has five traditional…
Q: Explain how human hunting has affected the traits of the African elephants. Explain why being a…
A: Elephants are the largest land mammals on earth and have distinctly massive bodies, large ears, and…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: RNA polymerase is an enzyme that synthesis the RNA by following a strand of DNA. It is responsible…
Q: Describe the way turfgrasses grow. What has influenced their evolution and whatimplications does…
A: Evolution is the change in characteristics of a species over a large period of time over its…
Q: Which of the following pieces of evidence are used to construct a cloudogram? Choose all that apply.…
A: Introduction :- A cladogram is a diagramatic tool used in cladistics to depict how species are…
Q: What is the genetic phenomenon when a person has a specific genotype but phenotypically presents…
A: Genotype is defined as the genetic constituent of an organism. where is the phenotype is defined as…
Q: What is Enterobacter aerogenes? What did Enterobacter aerogenes cause?
A: Enterobacter aerogenes is a rod shaped, gram-negative, pathogenic bacteria. It is also called…
Q: THE EFFICIENCY OF EVALUATING THE OPERATION OF THE HOOD 1. carbon monoxide content in air 2. the…
A: The airflow (velocity) at the hood entrance and inside the hood has to be sufficient to collect and…
Q: Define the following terms: culture: synthetic media: complex media: agar:…
A: Introduction Microbiology:- It is the study of all living organisms that are too small to be visible…
Q: Based on the fish dissection, describe the structure of skull and vertebral column design. How does…
A: Answer
Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…
A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…
Q: To explain: Which component does the KDEL receptor bind its ligand more tightly and more weakly.
A: Proteins are the fundamental building blocks of many biological structures, including cell…
Q: difference between veld and cultivated pasture
A:
Q: Suppose you had a method of cutting DNA at specific sequences of nucleotides. how many nucleotides…
A: DNA (deoxyribonucleic acid) is the hereditary material in humans and almost all other organisms.…
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: Urine Volume Cases Urine Concentration Dehydration Increases Decreases Exercise Increases Decreases…
A: Given: Diabetes is referred as a chronic health condition that affects the body consumption of food…
Q: Account for the success of parasitic protozoans. Cite specific strategies employed by these…
A: Protozoa are the microorganisms visible under microscope. They are unicellular and Eukaryotic…
Q: Compare and contrast the efficiency of the different organ systems and adaptations between…
A: 1.)Cnidarians are diversified animals than ctenophores. Cnidarians live in both freshwater and…
Q: 2. Why do we use samples in the collection of data?
A: Introduction Scientific data:- It is defined as information collected using particular methods for a…
Q: Suppose that the circulating concentration of hor-mone is 10–10 M and the Kd for binding to its…
A: To function properly, the body generally knows that they are supposed to require coordination…
Q: Part A: A wild-type fruit fly with a smooth body, straight wings, red eyes and paired antennae (br+,…
A: Answer given in step 2. Please find the attached immage. Thank you.
Q: In the adaptive immune response which antigen are mount cellular responses? T helper lymphocytes T…
A: Answer
Q: Draw a simple diagram illustrating alternation of generations in plants, including the sporophyte…
A: The alternation of a sexual phase (n) and an asexual phase (2n) in the life cycle of an organism.…
Q: INDICATOR INDIRECTLY INDICATING FOR LONG WATER POLLUTION BY HOUSEHOLD-CONSUMER WASTE WATERS 1.…
A: Chemical contamination of water sources causes water to become unsafe for consumption, cooking,…
PLEASE ANSWER WHY?
Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutationThe effect of base-pair substitution mutations on protein function varies widely from no detectable effect to the complete loss of a protein function. Why the functional consequences of base-pair substitution vary so widely?A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly describe these mutations? They are permanent and cannot revert or reverse mutate back into a wild-type sequence. They cause a non-functional amino acid to replace a functional amino acid. O They result in the insertion or deletion of a small number of nucleotides to the DNA. They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein. None of the provided answers are correct. They convert a codon for a particular amino acid within a gene into a stop codon. They insert an additional amino acid into the final protein product.
- You suspect a protein that is being expressed has been affected by a mutation. When you examine the fully functional protein you find curiously that it still has retained all of its overall function. A friend of yours doing research with you assures you when examining the genetic data a new mutation does in fact exist in this protein. What is the most likely type of mutation that occurred based on this information? Group of answer choices frameshift mutation silent mutation nonsense mutation. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?Explain why a point mutation does not necessarily change the oriignal amino acid sequence. Explain silent mutations.
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-GlA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro