Explain why a point mutation does not necessarily change the oriignal amino acid sequence.  Explain silent mutations.

Explain what is meant by loss of function mutation. Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a gene  Explain the underlying cause of inborn errors of metabolism (a diagram can be used to illustrate your answer). Give an example of an inborn error of metabolism and explain how the underlying genetic defect leads to the symptoms seen in the disease

If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein remains functionally the same; which of the following would best describe the result of this mutation? 1) frameshift mutation. O 2) insertion mutation. O 3) silent mutation. 4) nonsense mutation. O 5) back mutation.

Galactosemia is a metabolic disorder characterized by the inability to metabolize the sugar galactose. People with galactosemia suffer from liver, kidney, and brain damage among other symptoms. A gene mutation underlying galactosemia was identified by sequencing the genome of a person with galactosemia. What additional evidence would support the hypothesis that the mutation in the candidate gene causes the disease?

A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’   what type of mutation is this?   Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?

Explain the factors of aminoacylation of Trna?

Early detection and adherence to a strict dietary regimen have prevented much of the intellectual disability that used to occur in those with phenylketonuria (PKU). Affected individuals now often lead normal lives and have families. For various reasons, such individuals tend to adhere less rigorously to their diet as they get older. Predict the effect that mothers with PKU who neglect their diets might have on newborns.

Define and compare the outcomes of the following types of nucleotide substitutions, insertion or deletions. Which is likely to cause the least dramatic mutant effect? a) missense mutations b) nonsense mutations c) frameshift mutations d) silent mutation

Explain the reasoning for the establishment of three nucleotides codons.

In the image below, the blue squiggly line represents a folded protein. There are two particular amino acids that are colored red and black in the protein. The structure of each of these two specific amino acids is shown in the indicated box. A mutation occurs in the gene that encodes the protein illustrated above. The result of this mutation is that one of the amino acids above is substituted with another. Specifically, the amino acid whose structure is shaded red above (the one on the left in the illustration) is replaced by the amino acid shown below. Use this information to answer the two questions that follow. Please answer these questions.  1. Based on this description, indicate which type of mutation occurred: missense, nonsense, silent, or indel 2. How would this mutation affect this protein's structure and function? Explain in 2-4 sentences. Be specific, and be sure to include details of these specific amino acids in your response. (I'm giving you the…