
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Explain why a point mutation does not necessarily change the oriignal amino acid sequence. Explain silent mutations.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardDoes a mutation always result in a change of an amino acid sequence in protein? Why?arrow_forwardIdentify a disease or condition related to protein mis-folding. Which protein is misfolded? Is this a genetically inherited condition or is it transmissible?arrow_forward
- Explain what is meant by loss of function mutation. Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a gene Explain the underlying cause of inborn errors of metabolism (a diagram can be used to illustrate your answer). Give an example of an inborn error of metabolism and explain how the underlying genetic defect leads to the symptoms seen in the diseasearrow_forwardIf the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein remains functionally the same; which of the following would best describe the result of this mutation? 1) frameshift mutation. O 2) insertion mutation. O 3) silent mutation. 4) nonsense mutation. O 5) back mutation.arrow_forwardGalactosemia is a metabolic disorder characterized by the inability to metabolize the sugar galactose. People with galactosemia suffer from liver, kidney, and brain damage among other symptoms. A gene mutation underlying galactosemia was identified by sequencing the genome of a person with galactosemia. What additional evidence would support the hypothesis that the mutation in the candidate gene causes the disease?arrow_forward
- A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?arrow_forwardExplain the factors of aminoacylation of Trna?arrow_forwardEarly detection and adherence to a strict dietary regimen have prevented much of the intellectual disability that used to occur in those with phenylketonuria (PKU). Affected individuals now often lead normal lives and have families. For various reasons, such individuals tend to adhere less rigorously to their diet as they get older. Predict the effect that mothers with PKU who neglect their diets might have on newborns.arrow_forward
- Define and compare the outcomes of the following types of nucleotide substitutions, insertion or deletions. Which is likely to cause the least dramatic mutant effect? a) missense mutations b) nonsense mutations c) frameshift mutations d) silent mutationarrow_forwardExplain the reasoning for the establishment of three nucleotides codons.arrow_forwardIn the image below, the blue squiggly line represents a folded protein. There are two particular amino acids that are colored red and black in the protein. The structure of each of these two specific amino acids is shown in the indicated box. A mutation occurs in the gene that encodes the protein illustrated above. The result of this mutation is that one of the amino acids above is substituted with another. Specifically, the amino acid whose structure is shaded red above (the one on the left in the illustration) is replaced by the amino acid shown below. Use this information to answer the two questions that follow. Please answer these questions.  1. Based on this description, indicate which type of mutation occurred: missense, nonsense, silent, or indel 2. How would this mutation affect this protein's structure and function? Explain in 2-4 sentences. Be specific, and be sure to include details of these specific amino acids in your response. (I'm giving you the…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education