CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: DNA polymerases used in PCR _______.

A: The polymerase chain reaction (PCR) is a technique in which millions of copies of the desired DNA…

Q: Cons of CRISPR

A: The cons or disadvantages of CRISPR  are as follows:

Q: “DNA polymerase plays a dual function during DNA replication” comment onstatement?

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: True or false: After chromosomal replication, Type I topoisomerase is used to coil up the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What dna polymerase is used for Sanger sequencing

A: Sanger sequencing, also known as dideoxy sequencing, is a widely used method for determining the…

Q: DNA Extraction using Tomato     DNA Extraction by Mouthwash

A: DNA extraction is a technique for isolating DNA from cell membranes, proteins, and other biological…

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: identify the 3' and 5' ends of the DNA segment AGTCAT

A: Deoxyribonucleic acid (DNA) is the genetic element composed of two polynucleotide chains which coil…

Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…

A: Transcription is the process in which m RNA is synthesized and the translation is the process in…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: You are asked to participate in a clinical trial for a new drug that can activate telomerase. Cancer…

A: Cancer  The unlimited, abnormal division of cell is known as cancer. In cancer the cell is divide…

Q: Does each sample contain pure DNA? How do you know?

A: Not necessarily all the samples will have pure DNA it may have contaminations and the level of…

Q: Answer the following questions based on the given the sequence of nucleotides in a DNA molecule…

A: Given:- The sequence of nucleotides in a DNA molecule:- 5'…

Q: Describe post-transcriptional modifications that occur in mRNA and tRNA. Please type your answer.…

A: mRNA is known as massanger RNA. About 3-5% of the cellular RNA are of m-RNA type. It is linear in…

Q: Mutations in DNA of an organism can be ___________________.     harmful to the organism…

A: The mutation is an unpredictable and random phenomenon. Mutation can be spontaneous or take place…

Q: lentify the various types of DNA repair mechanisms known to counteract the effects of UV Padlatloh.…

A: Photoreactivation repair- It is the recovery of ultraviolet irradiated damages of DNA by visible…

Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…

A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…

Q: why was glycerol added onto the total dna buffers?

A: The effect on DNA separation of adding glycerol to the running buffer was studied using linear…

Q: Why was it necessary to soak the gel in hydroxide before performing the blot?

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: Why were you able to see the DNA after adding the ethanol?

A: Introduction :-DNA contains information needed to create proteins, which are other big molecules.…

Q: Write the name of disease occur due to Nonhomologous End Joining Repair.

A: When their is defective  Function of DNA  break repair , then it is known as DNA repair defect which…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors,  The…

Q: Where does the process of transcription start on the strand of DNA?____        Where does the…

A: Transcription is that the process of creating an RNA copy of a gene sequence. This copy, called a…

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: What is the translated sequence

A: Given the DNA  sequence,  and we have to translate it into amino acid sequence .

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Compare, substitution, insertion, deletion to the normal gene.

A: Mutation refers to the alteration of the nucleotide sequence of the gene. Types of mutation include…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: it have gaps that would remain in newly synthesized DNA from lagging strand

A: DNA ligase enzyme helps in phosphodiester bond formation between the 3'-OH group at the end of one…

Q: The cytoplasmic granule of RNA andprotein that reads the message in mRNA isa/an ____________________

A: The central dogma of molecular biology describes the flow of genetic information in cells from DNA…

Q: Why were both “+ DNA” and “- DNA” mixtures prepared and plated?

A: Both “+DNA” and “-DNA” mixtures prepared and plated because in the transformation protocol “+DNA”…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Look at the amino acid chart below that the proctor placed on a board at the front of the classroom…

A: Sickle cell anemia is an inherited blood disorder that affects the structure and function of red…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.