Select all that apply Choose the two nucleotides that are typically used in prokaryotes as the first nucleotide in the RNA transcript. O GTP CTP OUTP ATP
Q: A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has…
A: The pre-initiation complex forms at the core promoter to initiate the transcription of the…
Q: 97 Which of the following is examples of a transposable element found in bacteria? (multiple choice…
A: Note- we are supposed to answer three question according to our guidelines, please repost other…
Q: Prokaryotic cells can have more than one functional start codon per MRNA because O prokaryotic…
A: Start codon is present as the first codon which initiates the translation process. Start codon is…
Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…
A: Gene is the sequence of nucleotide that encodes a specific protein.
Q: CRITERIA PROKARYOTE EUKARYOTE Site of Transcription Initiation of Transcription Termination of…
A: The manner by which genes express themselves is known as the core dogma of life. The way in which…
Q: Identify a Transcription Factor (TF) / DNA Regulatory Protein (DRP) that is functional in Humans…
A: Answer: Introduction: Eukaryotic cellular process is regulated in the transcription process and RNA…
Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…
A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…
Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…
A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…
Q: Which molecules are required during Translation? Choose ALL that apply Select all that apply:…
A: In biology & genetics, translation is defined as the interaction wherein ribosomes in the…
Q: Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to…
A: a) SWI/SNF It is composed of various proteins and act as an ATP-dependent chromatin remodeling…
Q: MRNA degradation in prokaryotes occurs using endonuclease exonuclease both
A: In prokaryotes, mRNA degradation is an important and necessary process to control gene expression…
Q: а. WHY do prokaryotes use operons? b. Fill out the following table: Mechanism Requires/Uses Results…
A: A) An operon is a cluster of genes that are transcribed together to give an uncoupled messenger RNA…
Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…
A: Given: A gel. This gel shows the result of a Sanger sequencing run of part of Exon 3 of the Mstn…
Q: Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the…
A: Transcription is the process of copying genetic information from DNA (Deoxyribonucleic acid) into…
Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…
A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…
Q: Consider a human lover cell vs a cheek cell: Explain whether the following components are…
A: Introduction: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a…
Q: This sequence element is found in RNA and is critical for prokaryotic translation. O Shine-Delgarno…
A: Translation involves translating the sequence of a messenger RNA (mRNA) molecule to a sequence of…
Q: Target of doublestranded rna during RNAi is determined by...... size molecular weight…
A: The gene expression and the stability of mRNA can be regulated by using RNAi techniques in which a…
Q: Matching type. Match column A with column B. Your answer in column B should be matched with column…
A: Molecular biology has become the most recent tool added to the study of genetics. It provides…
Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…
A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…
Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…
A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…
Q: Messenger RNA Iis single-stranded molecule while RNA and rRNA molecules are double-stranded…
A: Ribonucleic acid (RNA) is a biomolecule that takes part in a wide array of biological roles.
Q: Choose all that apply regarding gene transcription in eukaryotes: Exons are removed from mRNA by…
A: Gene Transcription in eukaryotes is s multistep process requiring the participation of three RNA…
Q: A.Give the transcript that will be formed from this template. 3- TACGGGTTATATTCAATC-5" B.Give the…
A: The DNA is copied into RNA (transcript) by a process called transcription. It takes place inside the…
Q: Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ…
A: A sigma factor or specificity factor refers to the protein factor required for the transcription…
Q: Matching Match each item with the correct statement below. Not all terms will be used a. 5' GTP cap…
A: Introduction Gene expression is the process through which information from a gene is utilised in the…
Q: posted 8 months ago (last edited 5 mont Mechanism of Microbial Genetics Prior to the elucidation of…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: AKS 5c1: A section of a nucleic acid is shown in the model below. The process represented in the…
A: Nucleic acids are one of the most important biomolecules of living system. There are two types of…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…
Q: Complete the sentences below using the words and phrases on the left. Then arrange the text boxes to…
A: 1) DNA double helix, open promoter complex 2) Transcription mRNA, hairpin loop 3) Sigma factor
Q: Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are…
A: Transcription in eukaryotes.
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…
A: Answer option ll will result in shorter strand
Q: n prokaryotes, transcription and translation occur ________. simultaneously simultaneously in…
A: Transcription is the process of copying a segment of DNA to make an RNA copy. The RNA formed is…
Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…
A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…
Q: Matching type Choices are in the picture 11. regulating elements in the operon 12. ribosome…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: Which molecules are required during Translation? Choose ALL that apply
A: Central dogma consists of replication, transcription and translation. Replication is the formation…
Q: Which of the following statements is true?a) Exonuclease III removes nucleotide residues from the 3’…
A: b) Bacteriophage lambda exonuclease removes terminal phosphates - Bacteriophage lambda exonuclease…
Q: 4. Please propose an experimental design to address the following hypothesis: Eukaryotic initiation…
A: DNA is transcribed to form mRNA. In eukaryotes, pre-mRNA is processed post-transcriptionally to form…
Q: Translation a. In the diagram above, draw a rectangle around the part that represents translation.…
A: Need to answer the questions related to translation process. Need to determine the step by step…
Q: Translocation during translation requires energy from the hydrolysis of Select one: O a. GTP O b.…
A: Translation is the process of formation of proteins from amino acids that are synthesized by the…
Q: Sene edits can be made to Eukaryotic DNA by using a complex composed O Progenitor cell and 4 master…
A: Gene editing is a group of technologies that give scientists the ability to change an organism's…
Q: sequences oT two con the following bacterlal promoter. The startpoint of transcription is shown in…
A: Transcription is the act of copying and interpreting information from a DNA strand into a new…
Q: Matching type Choices are in the picture 6. RF1 and RF2 recognize the three bases to terminate the…
A: Transcription is the process in which the DNA molecule information is copied into RNA molecule. The…
Q: Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose…
A:
Select all that apply Choose the two
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…The subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motif
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysAGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
- Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrArthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol I'm DONE being this guy's messenger boy Bod Moeba Sreters He can leave the (nucleus and do it himself for all I carel Arthur, the mRNA, was at the end of his strand at work.Many primary transcripts of noncoding RNAS must be _in order to be functional. * none of the above replicated O polyadenylated translated O processed