Referring to the figure below(first picture) explain photosynthetic electron transport. Then compare the process outlined in the figure with figure 1(second picture), What are the similarities and differences?
Q: 1.a)Which one of the following is NOT broken down by the amylase enzyme? Amylopectin Starch Sucrose…
A: Enzymes are biological catalyst that speed up biochemical reactions. Enzymes are highly specific in…
Q: 1. What is Du? ESTIONS ON LABORATORY ASSAY NO.7 2. Why do we need test for Du when weak or no…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 3. Some proteins are membrane bound and have segments (called transmembrane domains) that pass…
A: There are different proteins associated with lipid bilayer and they perform different functions.…
Q: please answer and expalin in detail Please provide only typed answer solution no handwritten…
A: The citric acid cycle (also known as the TCA cycle or Krebs cycle) is a series of chemical reactions…
Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 4. At pH 9.5, what is the net charge of the peptide LTDQRHGE?
A: Peptide is composed of polymer of amino acids (length of 13 to 17 amino acids) which is linked by…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: Comparing chymotrypsin and subtilisin active site geometries on the assumption that their…
A: The approach of comparing the active site geometries of chymotrypsin and subtilisin to gain insights…
Q: In bacterial teansfomation, why is 42oC being used as the chosen temperature for heat shock…
A: In bacterial transformation, heat shock is used to increase the efficiency of the transformation…
Q: 2. A mutation that changes an alanine residue in the interior of a protein to valine (A157 → V157)…
A: Different protein gain its three dimensional structure after folding, which occurs according to the…
Q: Create a CLEAR concept map connecting cancer and glycolysis (warburg effect)
A: The Warburg effect named after Otto Warburg, a German physiologist is a feature exhibited by cancer…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: Fill in the blank 1.) triaycerols form_____ rather than lipid bolsters 2.) the most abundant…
A: Triacylglycerols are fatty acid esters of glycerols, with 3 fatty acids (long hydrocarbon chain…
Q: Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenase Outline the…
A: Enzymes are essential for the functioning of living cells and play a crucial role in maintaining…
Q: 1. If Ser 80 was replaced with Arg what kind is the change in the bond type between these two…
A: the stability of an amino acid is influenced by the specific interactions it forms with other amino…
Q: (d) NH + (a) CH₂ CH₂ (b) O-H-- CH H-C CH₂ CH3 CH₂COOH H H CH₁ CH, (c) 5 5 (b) CH₂ CH₂ CH₂ CH CH (d)…
A: Proteins are the macro molecules that show diversity in their structure by possessing four levels of…
Q: 2. Here is data to plot another STANDARD CURVE... Again, carefully consider how to scale and label…
A: Polyacrylamide gel electrophoresis (PAGE) is a technique used to separate proteins based on their…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: Connect the optimum ph each emzine to their location in the body
A: Enzymes are biological catalysts that catalyse biochemical reactions. An enzyme's activity refers…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: 1. what cause the reaction of the rancid oil to ph paper to be different from that fresh oil 2.…
A: The biological macromolecules can be classified a nucleic acids, proteins, lipids and carbohydrates.…
Q: 1. Answer the following questions: a. A substance produced from pyruvate that is a precursor in the…
A: Glucose is the simplest carbohydrate, which is utilized as the primary source of energy. The complex…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: HO H. OH 2-H OH OH 20. To the left is the structure of ribose, with (most of) the carbons numbered.…
A: Ribose is a five-carbon monosaccharide that is a component of nucleotides, the building blocks of…
Q: A. Draw the structure of the following peptide sequence at pH 2.0: ASP-ALA-THR-LYS-GLY B. What is…
A: Amino acids are basic building blocks of polypeptides, and one or more of these polypeptides they…
Q: 1. what is the reason why lactose is considered to have the least sweet taste from all other kinds…
A: Carbohydrates are one among the 4 classes of biomacromolecules. Based on the number of units…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: In isolating and characterizing carbohydrates, choose between starch and cellulose from a plant…
A: Carbohydrates are composed of carbon, hydrogen and oxygen (CH2O) which performs several functions in…
Q: Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene…
A: Mutations in the following gene gives rise to a genetic disorder known as Xeroderma pigmentosum.…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: For the enzyme reaction mechanism with an inhibitor that produces product from both ES and EIS, E +…
A: Enzymes are proteins that act as catalysts to speed up biochemical reactions in living organisms.…
Q: Why does casein precipitates upon the addition of acetic acid? Why is milk used as an antidote in…
A: Proteins are primarily composed of one or more polypeptide chains. Every polypeptide chain is a…
Q: 1)s. Name an enzyme that requires NAD/NADH for activity. Draw the chemistry of this reaction (show…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: The unicellular fungus Saccharomyces cerevisiae is used in the food industry to ferment sugars. The…
A: In animals, Pyruvic acid has two possible fates in the cell: be oxidised into acetyl CoA and enter…
Q: Assume that the experiments performed in the absence of inhibitors were conducted by adding 5 μL of…
A: We are asked to find some enzyme kinetics parameter that has a unit of s-1 . And in order to find…
Q: When the disaccharide is hydrolyzed, the monosaccharide units that are produced are
A: Carbohydrates are one of the three macronutrients that provide energy to the body, the other two…
Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…
A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: Human insulin is prodụced as a recombinant protein in the yeast Saccharomyces cerevisiae The protein…
A: A glycosylated protein is a protein that has a carbohydrate moiety attached to it. Given to us are…
Q: Describe how will you dilute a 10X stock solution into 5X, 2X, and 1X, respectively.
A: INTRODUCTION : Diluting a Stock solution - A stock solution is a high or medium concentrated…
Q: Give typed answer with explanation Draw the structure of arginine indicating the charged form that…
A: Amino acids are biomolecules in which an amino group, a carboxyl group and a side group are linked…
Q: A) Polymer Lipid DNA B) Monomer (or component units in the case of lipids). Draw the specific…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What chemicals do you think are most harmful to your own health? How are you exposed? How could you…
A: Benzene and other aromatic hydrocarbons, along with heavy metal compounds are one of the the most if…
Q: What is the pH of a 0.150 M solution of acetic acid (pK₂ = 4.75) at 25 °C?
A: Acetic acid is a weak acid, it doesn't dissociate completely in a solution like strong acids(HCl,…
Q: Based on your knowledge of the natural amino acids, what would you expect pKa of the side chain of…
A: Succinic acid have 4 carbons, among which the two terminal carbons are carboxylic acid groups. The…
Q: In mice, the a mutation results in albino mice, while mice with at least one copy of the A allele…
A: The test cross is done between an organism of dominant phenotype and an organism with a homozygous…
Q: What is misleading about the term hydrophobic bond? What drives the hydrophobic effect? How is it…
A: Introduction Hydrophilic molecules are water loving groups and are soluble in water. But hydrophobic…
Q: Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenase Outline the…
A: The tricarboxylic acid cycle is the metabolic pathway that generates NADH and FADH2 from the…
Q: Is vitamin c portly soluble of immediate solubility or highly soluble and what are the mol 1-1
A: Vitamins are small molecule which are required for normal functioning of the body. These molecules…
Referring to the figure below(first picture) explain photosynthetic electron transport. Then compare the process outlined in the figure with figure 1(second picture), What are the similarities and differences?
Electron transport in oxygenic photosynthesis is a highly regulated process that involves the coordinated action of multiple protein complexes and pigments. The electrons are passed along a series of redox reactions, with energy being released at each step to drive proton pumping and ATP synthesis. Ultimately, the electrons are used to reduce NADP+ and produce NADPH, which provides the reducing power necessary for carbon fixation and other biosynthetic processes.
Photosynthetic hydrogen production involves the transfer of electrons from water molecules to protons, resulting in the production of molecular hydrogen. The electron transport process is somewhat similar to the electron transport observed during oxygenic photosynthesis with some differences that are mentioned below.
Step by step
Solved in 3 steps
- Using the ActiveModel for phosphofructokinase (Trypanosoma), describe the difference between the APO1, AP02, and holoenzyme conformations.avelengths (Choose J |Choose | graph plotting a pigment's light absorption versus wavelength reaction- center complex is system consists of a reaction-center complex surrounded by nt-harvesting complexes absorption spectrum spectrophotometer molecule located in the reaction center accepts excited ctrons photosystem light harvesting complex reaction-center chlorophyll a of this photosystem iş called P680 ause it is best at absorbing a wavelength of 680 nm. primary electron acceptor wavelength PSI estion 4 PS II action spectrum >The photosynthetic process used by the green sulfur bacteria, under anaerobic conditions, is best represented by which of the following balanced equations? cell bio 6CO2 + 12H2S C6H12O6 + 6S2 + 6H2O C6H12O6 + C6H12O6 C12H22O11 + H2O 6CO2 + 12H2O C6H12O6 + 6O2 + 6H2O C12H22O11 + H2O C6H12O6 + C6H12O6 C6H12O6 + 6O2 + 6H2O 6CO2 + 12H2O
- This is a linear biochemical pathway 2 ATP + HCO₂ + NH₂ 2 ADP, PCPS-1 H₂N OPO, NH₂ CH₂ CH₂ CH₂ HỘ NHĨ coo 1 H₂N NH₂ 7 True False ARG1 P отс fessels. çoo CH HC 5 Sassets. ASL NH₂ HỘ NHỎ ASS N_y_coo NH CHI CH₂COO CH₂ CH₂ HỘ NHỎ coo 4 ATP PP L-Asp AMP 1 L-ornithine 2 carbamoyl phosphate 3 L-citrulline 4 argininosuccinate 5 fumarate 6 L-arginine 7 urea L-Asp L-aspartate CPS-1 carbamoyl phosphate synthetase I OTC Ornithine transcarbamoylase ASS argininosuccinate synthetase ASL argininosuccinate lyase ARG1 arginase 1 OH OH NH₂CHO CHO CH,OH HO- H Phosphorogluco- isomerase Phosphofructo- kinase Hexokinase но H. но -H- но H- HO- АТР ADP H- HO- -HO- OH H- OH H- OH Via H- -HO- ATP ADP CH2OH CH,OPO,2 ČH,OPO,2 Но nin Glucose A B CH,OPO,2- CH2OPO, Fructose Fo D CH2OH Но H- biphosphate H- HO. HPO,2 / NAD+ / Triose aldolase OH Glyceraldehyde 3- phosphate dehydrogenase phosphate isomerase CH,OPO,2 Via OPO,2 сно HOH E CH,OPO, H- OH LOH CH,OPO, For CH,OPO,2 G COPO,2 он H3C HO. Pyruvic Acidx 'x Paragraph Font Activate ures of Word have been disabled because it hasn't been activated. Use the lettered items below to correctly identify the numbered items (86 to 97) in the dia- "Io aoo) an ouo sasaodsar mod proay uRS 6 NADH 2 ATP (net) 2 NADH 36 or 38 ATP 6 ATP 2 ATP 18 ATP 4 ATP 4 FADH, 4 or 6 ATP 2 FADH, # ATP ascon glycolysis 88 68 Pyruvate L6 06 acetyl CoA 91 Krebs 93 92 cycle 94 95 Total Theoretical ATP Yield%3D 96
- SPS Date: Page No. A pulse af 13-14c] of pyruate con tans 4c) js methylgiaup. added toa do0lated mitachondria. Prruiate (the 'Riuspension of solated mitochondoria Aften (Q ane tuen of c gcid cycle, which canlion co e (ore) labeled in Daaloocetate? he citri'c loore) labeledin Draw f caid crle infermedictes t shau hene the labreled the structures ALL the cetrec tohone canban ie ih erch one. (t How needed to nelecse caribon many tong the Gycle would te Eycle,Wou all the labeled as 1"cog? Explain your answer.Calculate (in kJ/mol) the energy that is required by the Rhodopseudomonas viridis photophosphorylation system to synthesize 3 ATP? (Assume that the R. viridis F1F-ATP synthase c-subunit rotor contains 12 c-subunits and that the R. viridis cytochrome b/c complex translocates 2 H/e". Also assume that the wavelength of lig! is 680 nm.) Number of photons required to synthesize 3 ATP = photons Energy = kJ/molGive a more in deapth explaination
- One of the steps in psilocybin biosynthesis is the phosphorylation of 4-hydroxytryptamine By the enzyme Psik as shown below, that involves the hydrolysis of ATP. NH₂ OH HO Psik HO of A& ADP 4-hydroxytryptamine ATP norbaeocystin The standard free energy changes for each reaction is shown in the Table below. J reaction 4-hydroxytryptamine + P₁ → norbaeocystin ATP → ADP+ Pi (b) What is the equilibrium constant at 37 °C? AG 27.7 kJ/mol -32.2 kJ/mol (a) Write the net reaction. What is the standard free energy change for the net reaction? (c) In the cell, the concentration of ATP is 3.1 mM, the concentration of P; Is 5.90 mM, and the Concentration of ADP is 220 μM. What will AG Be if the concentration of norbaeocystin Is always kept at 1/100 of the concentration of 4-hydroxytryptamine?. The photosynthetic process used by the green sulfur bacteria, under anaerobic conditions, is best represented by which of the following balanced equations? 6CO2 + 12H2S g C6H12O6 + 6S2 + 6H2O C6H12O6 + C6H12O6 g C12H22O11 + H2O 6CO2 + 12H2O g C6H12O6 + 6O2 + 6H2O C12H22O11 + H2O g C6H12O6 + C6H12O6 C6H12O6 + 6O2 + 6H2O g 6CO2 + 12H2OCyclic photophosphorylation uses two photons to generate one ATP. If the AG of ATP hydrolysis is -50 kj/mol. What is the percent efficiency of cyclic photophosphorylation? F =96.5 kj/mol*V. Use c AG = -nFAV ⒸShow Transcribed Text to solve.