QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term for a gene), the genotype aa produces an agouti coat colour (a greyish colour) and the heterozygote Aa produces a yellow coat colour. The AA homozygotes, however, die very early in development - the yellow coat colour allele is a lethal allele when homozygous (clearly the encoded protein has functions other than simply coat colour). What is the expected phenotypic ratio of live mice resulting from a cross of two Aa mice? (Cross: Aa x Aa) OA. 3:1 agouti:yellow OB. 3:1 yellow:agouti OC. 2:1 agouti:yellow OD.2:1 yellow:agouti
Q: Before we conclude that mirror neurons help people imitate, which of the following should research…
A: Mirror neurons are a particular sort of brain cell which reacts the same way when we carry out an…
Q: Intracellular signaling pathways provide multiple opportunities for the amplification of a response…
A: there are several intracellular signaling pathways works together in a body that regulates normal…
Q: The somatic cells of a dog each contain 78 chromosomes. What is (are) the product(s) of…
A: The result is 39 chromosomes at the poles of the cell.
Q: how does COVID previously perceive to impact healthcare organizations and/or the healthcare…
A: The development of the coronavirus illness, that is brought on by transmission with the previously…
Q: Determine whether this statement is true or false: Aminoacyl-tRNA synthetase covalently links the…
A: Transfer RNA, often known by the acronym tRNA and formerly known as soluble RNA (sRNA), is an…
Q: The pedigree follows the inheritance of a relatively common trait. Is the trait most likely…
A: A pedigree chart depicts the family members who are impacted by a genetic trait and a family tree.…
Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…
A: In plants, Photosynthesis is the process of making food (glucose) and releasing oxygen by utilising…
Q: When genes from two parents mix together to form the genes of their child, this is called a.…
A: A gene can be described as the basic unit of inheritance. A gene is transferred from one generation…
Q: molecular motors
A: Molecular motor proteins: These are a class of molecular motors which move along the cytoplasm of…
Q: Explain the basis for tRNA synthetase genes in B. subtilis regulated by T-box RNA leaders.
A: RNA polymerase binds to the lac operon's promoter, which serves this purpose. The transcription…
Q: A 28-year-old woman has been sick with the flu for the past week, vomiting several times every day.…
A: Introduction : Normal blood pH level in humans ranges between 7.35 - 7.45 which is slightly basic.…
Q: 3.A human pedigree for inheritance of a disease determined by a mutation in a mitochondrial gene is…
A: Mitochondria in a cell have their own chromosome. Though the size is small and it codes for proteins…
Q: For each scenario, analyze the validity and reliability (determine if it is high or low). Explain…
A: A medical assistant is a person who helps a doctor with patients. They may do things such as taking…
Q: Explain why the three transformations produce different number of colonies, commenting on the…
A: Transformation is the process of gene transfer into bacteria in which the competent bacteria takes…
Q: The doctor ordered Piperacillin-Tazobactam 2 grams every 8 hours as IV infusion. The available vial…
A: The amount of drug given at one time to the patient is called a dose. The compounds used in medicine…
Q: Describe the steps including the roll of ion terminals in a neuronal action potential
A: An action potential is created when the voltage difference between the inside and outside of a…
Q: What determines the rhythm of a cat’s scratching movements, or the wet dog shakes? A. The rhythm of…
A: The spinal cord and brain make up the majority of the central nervous system (CNS), which is a…
Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…
A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…
Q: How are vesicles with neurotransmitter transported to the synaptic cleft? A. Retrograde, slow…
A: Nervous system is a body system which is involved in transmission of impulse, control as well as…
Q: ㅇㅁ ㅁㅁ 이미 ㅇㅇㅇ 움 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: The given pedigree has the following features: i) skips generation: affected children have both…
Q: What is energy cycle
A: The energy is the main thing that made the earth suitable for life. Every living organisms need…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…
A: Introduction Stroma is important as it consists of enzymes required for the fixation of carbon…
Q: Which cytosines could be methylated in a typical mammalian genome? Why? 5’-GCCGCGC-3’
A: DNA is the genetic material in living organisms that contain two polynucleotide trends. DNA contain…
Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…
A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…
Q: whats the difference between a chromosome, a chromatin, and a chromatid?
A: DNA is genetic material in living organisms that is composed of two polynucleotide stands. It…
Q: What is the lac operon?
A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…
Q: With the help of well labelled diagram describe the structure of a archaeal cell.
A: Archaea is a prokaryotic domain that are present throughout the biosphere. Many genera are…
Q: In general, what is known about the prevalence of Hepatitis C, and how it can be transmitted? 2.…
A: Answer 1. With around 2 to 3% of the world's population carrying the illness, HCV is growing more…
Q: Define hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: Hormone: A class of signalling molecules known as hormones—or "setting in motion"—are found in…
Q: Which of the following is UNTRUE with regards to human gametes and their production: A. Female…
A: A. Female gametes complete Meiosis II only after fertilization - true Explanation - Oogenesis• Each…
Q: I was also wondering is it possible to work out the mass required to make up the solution also?
A: stock solutions does not influence the concentration of the soltute by dilution it only increase…
Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…
A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…
Q: how will you lead a discussion through facilitation on the topic hiv/aids within the workplace
A: More options than ever before are available to lower the risk of contracting or spreading HIV.…
Q: THIS IS BABY's CORD BLOOD SAMPLE. The letters on the cell represent BABY's RBC antigens, those…
A: The ABO blood group system is used to denote the presence of one, both, or neither of the A and B…
Q: Armadillos spend a lot of time digging in soil find insects and plant roots to eat as well as make…
A: Digging is considered as a major type of activity in armadillos life because its their habit to dig…
Q: Haemophilia A is a severe coagulation disorder that shows X-linked recessive inheritance. Red-green…
A: Hemophilia is typically an inherited bleeding disorder where the blood does not clot properly. This…
Q: Which among the following statements is INCORRECT? The first event in the Calvin cycle is the…
A: Calvin pathway occurs in all photosynthetic plants, that is operated in cyclic manner. Calvin cycle…
Q: State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the…
A: The end of a DNA fragment ending with BamHi has a 50% chance of making BamHi junction and 25%…
Q: Determine the experimental design that makes the difference between the given two modes of action at…
A: The antisense ribonucleic acid is a type of single-stranded ribonucleic acid molecule that binds to…
Q: 27) A tRNA is activated when it A) attaches to mRNA. B) attaches to its specific amino acid. C)…
A: A form of RNA molecule called transfer ribonucleic acid (tRNA) aids in the translation of a…
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: Hello, thank you for the question. As you have posted a question with multiple subparts and all of…
Q: Which method of drug administration offers the highest control over dosage and delivery, but also…
A: Answer : method of drug administration offers the highest control over dosage and delivery, but also…
Q: 46. List 3 parts of the brain that are specifically involved in memory a. Amygdala, Hypothalamus,…
A: The neuroanatomy of memory includes a broad range of brain structural features. It is now obvious…
Q: What happens during the carbon fixation stage of the Calvin Cycle (light-indepedent reactions)?…
A: The Calvin cycle or light independent reactions follows three essential steps. These stages are…
Q: Describe the lac operon
A: Lac operon, this concept was proposed by Jacob and Monod in 1965. An operon is a functioning unit of…
Q: 2.(3 pts) A normal red blood cell is small and shaped like a flattened disk. The interior of a red…
A: Introduction : Osmosis is the movement of water molecules passing from a less concentrated solution…
Q: What is the description of the growth and growth pattern of the microorganisms in the pour plate…
A: Microbial cultures can grow in both solid and liquid mediums. A solidifying agent, such as agar, is…
Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…
A: Introduction:- The true breeding plant varieties means that they are homozygous ( genotypically) for…
Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…
A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Equalizing the Expression of X Chromosome Genes in Males and Females Individuals with an XXY genotype are sterile males. If one X is inactivated early in embryogenesis, the genotype of the individual effectively becomes XY. Why will this individual not develop as a normal male?Question 42 alpha-globin in cow and pig orthologous genes O paralogous genes O pseudogenes O all of theseQuestion for assignment: Using a transgenic technique, propose an experiment to determine whether Cdx2 is sufficient for trophoblast development in the mouse embryo. Describe two results that you would expect to observe at the blastocyst stage if Cdx2 is indeed sufficient for trophoblast development. Be as specific as possible regarding the transgene that you propose for this experiment (including what gene's enhancer you would use in the transgene). Note: you do not need to explain the details of how a transgenic mouse is made. Describe the experiment in steps (Step 1: ..., Step 2: ... etc) and please keep your answer to under 150 words. TIPS FOR ANSWERING: DONT talk about stop cassetes/memory cassetes, focus on transgenes Paper (Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocust) gave lots of results that you might see,, 6 diff ways that cdx2 is required for trophoblasts need specific gene enhancer (dont just say…
- Question for assignment: Using a transgenic technique, propose an experiment to determine whether Cdx2 is sufficient for trophoblast development in the mouse embryo. Describe two results that you would expect to observe at the blastocyst stage if Cdx2 is indeed sufficient for trophoblast development. Be as specific as possible regarding the transgene that you propose for this experiment (including what gene's enhancer you would use in the transgene). Note: you do not need to explain the details of how a transgenic mouse is made. Describe the experiment in steps (Step 1: ..., Step 2: ... etc) and please keep your answer to under 150 words. TIPS FOR ANSWERING: DONT talk about stop cassetes/memory cassetes, focus on transgenes Paper (below) gave lots of results that you might see,, 6 diff ways that cdx2 is required for trophoblasts need specific gene enhancer (dont just say "expressed enhancer in genital ridge")VARIATIONS IN GENE EXPRESSION In humans, the glucose-6-phosphate dehydrogenase (G6PD) gene involved in sugar metabolism is X-linked. The dominant allele (G) codes for fast enzymes for normal cell functioning while the recessive allele (g) codes for slow enzymes, which are responsible for the reduced enzymatic activity of cells. However, the presence of slow enzymes has minimal effect in the overall functioning of heterozygotes, thus normal. Recessives, however, are more prone to oxidative reactions that speed up the cell damaging process, thus weak (but not lethal). If random inactivation occurs during dosage compensation, what would be the genotypes and phenotypes of the children of a heterozygous mother and a recessive father? Show COMPLETE cross.Variations in Gene Expression In humans, the glucose-6-phosphate dehydrogenase (G6PD) gene involved in sugar metabolism is X-linked. The dominant allele (G) codes for fast enzymes for normal cell functioning while the recessive allele (g) codes for slow enzymes, which are responsible for the reduced enzymatic activity of cells. However, the presence of slow enzymes has minimal effect in the overall functioning of heterozygotes, thus normal. Recessives, however, are more prone to oxidative reactions that speed up the cell damaging process, thus weak (but not lethal). If random inactivation occurs during dosage compensation, what would be the genotypes and phenotypes of the children of a heterozygous mother and a recessive father? with COMPLETE cross
- QUESTION 2 Variable expression of the MERRF syndrome arises from recombination between nuclear and mtDNA O homoplasmic cells mitotic segregation nuclear genes environmental factorsPART 3– Sex Linkage Hemophilia is a recessive sex-linked disorder in which an important clotting factor protein (Factor VIII) is not produced in a functional form. Queen Victoria was a carrier of the recessive Factor VIII allele, meaning she carried the allele but was asymptomatic. Recently, historians have discovered that she secretly had an affair with the Austrian Count Chocula, who, unbeknownst to her, was a hemophiliac. Naturally, the Royal Family fought to have this information suppressed, but it was revealed that they had many children together. 1. Using the correct allele notation, write the genotypes for Queen Victoria and Count Chocula. 2. In the Punnett Square below, show the cross between the Queen and the Count. P> PĮComplementation tests of distinct recessive mutants, 1 through 8, produce the data in the matrix below. A plus (+) indicates complementation, meaning the phenotype of the combined alleles is wild type, and a minus (-) indicates a failure to complement meaning that a mutant phenotype results. Assume that the missing mutant combinations would yield data consistent with the entries that are shown. How many complementation groups are formed by these eight mutants? (Picture attached) A) 2 B) 3 C) 4 D) 5 E) 6
- Question 40 myoglobin and alpha globin in humans orthologous genes paralogous genes O pseudogenes O all of theseWhat phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation would have.Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense mutation in exon 3. You also isolate X-receptor proteins from wild-type (normal) cells. If you ran these protein molecules on a gel which are your predicted results? A В C Ladder Wild-type Mutant Ladder Wild-type Mutant Ladder Wild-type Mutant