
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Sample |
Relative Concentration of Tea Extracts |
% Inhibition |
Green Tea ( 0.25 mg ) |
0.25 |
0.974 |
Green Tea ( 0.5 mg ) |
0.5 |
0.967 |
Green Tea ( 0.75 mg ) |
0.75 |
0.965 |
Green Tea ( 1.5 mg ) |
1.5 |
0.959 |
Back tea ( 0.25 mg ) |
0.25 |
0.858 |
Black tea ( 0.5 mg ) |
0.5 |
0.976 |
Back tea ( 0.75 mg ) |
0.75 |
0.982 |
Black tea ( 1.5 mg ) |
1.5 |
0.969 |
plot the graph
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps with 3 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Time point (min) Absorbance of culture at 660nm Approximate cell concentration Approximate # cells in 1mL extract 0 0.298 1.49 x 108 cells/mL 1.49 x 108 cells 10 0.316 1.58 x 108 cells/mL 1.58 x 108 cells 20 0.374 1.87 x 108 cells/mL 1.87 x 108 cells 30 0.429 2.145 x 108 cells/mL 2.145 x 108 cells 40 0.512 2.56 x 108 cells/mL 2.56 x 108 cells 50 0.544 2.72 x 108 cells/mL 2.72 x 108 cells 60 0.607 3.035 x 108 cells/mL 3.035 x 108 cells a. Using these data, prepare a growth curve of this strain ofEscherichia coli (E. coli).b. Estimate the doubling time for this strain of E. Coli. Clearly showhow you estimated this value from the empirical data presented.arrow_forwardstock aliquot - 1mg/ml use the sequence below to determine the molarity using expasy prot program atgggcgaggagtataaagttgtcctcacatttggatccccaatgagccctaatgcaaataacaaacagacttgggttaataaacctcttgatgcgccttcgggccattacaatgtgaaaattgcaaaggatgttgaccactatctaaccatgcagggtttcacttctatagcatctgttgactggtacactatagattttcaaccatctgaggcgcctgccccgataaaaggcttgcaggtacttgtgaacatctcgaaaaaagctgatgtgtatgccgtcaaacaatttgtcacagcgcagaccaacaacaagcaccaggttacaagcctgttcctagtaaaagtaacaactggttttcaggtgaacaactacctgagttacttttacagggcgtctgctactggggatgccacaactaacctgttggttagaggagacacatacacagcagggataagttttacccagggtggatggtatttgttgacaaatacatctattgttgatggggctatgccacctggctgggtctggaataacgtggaacttaaaactaacacagcgtatcacatggacaaaggcttggtccatctaataatgcctttgcctgagtccacgcaaatgtgttatgagatgctgacatctattccagcggccgcagagctcgctctggtgccacgcggtagttccgctcatcaccaccatcatcaccatcaccaccactarrow_forward5 L of 0.2 M dextrose solution from 5 M dextrose solutionarrow_forward
- In which solvents or solutions will a steroid be soluble? Check all that apply. 9% aqueous LiBr solution CH₂Br₂ ☐ H₂O (CH3), CCH2CH2CH3 None of the above Garrow_forwardin food microbiology, how do you compute for concentration (M) and absorbance (A) of peroxidase activity on hydrogen peroxide at different pH values? (wavelength used = 415nm). can you please explain the calculations thank you if given: Temperature = 75 C Molar absorptivity coefficient = 10.5 Path length (cm) = 2 I = transmitted light = 0.45arrow_forwardGive the complete solution.arrow_forward
- Phenol Red Test Question: Assuming you tested an organism using Phenol Red glucose and Phenol Red Base broths, which of the combinations of results in the following table would be reliable. Interpret each of the combinations and explain how the results might be obtainedarrow_forwardTable 1 - Comparison of the effect of catechol concentration on the amount of product formed. Absorbance Potato extract Absorbance 0 mins after 30mins (2nd reading) (mL) 1st reading 1 Tube # la blank 2a 3a 4a 1 1 1 dH₂O Catechol (mL) (mL) 7 5 3 1 0 2 4 6 0.00 0.060 0.033 0-05-2 Q4) Give 2 reasons for adding dH₂O to these tubes in Table 1? Time for reading: 3:21 -0.11 Absorbance: Time for reading: 3.36 Q5) Tube la serves as a control, but why is this control needed? Absorbance: 0.197 Time for reading: 3.37 Based on the data from Table 1 answer these questions: Q1) What is the name of the enzyme found in potato extract? Answer: catechol Q2) What is the substrate? Answer: THO Q3) Name of product of this enzyme catalyzed reaction? Answer: Absorbance: 0.152 Time for reading: 3:39 Absorbance: . 166 ness Catechol Benzoquinone Subtract 1st from 2nd reading -0.01 0-137 0.11.19 0.119 Q6) Notice that your 1st absorbance reading in tubes 2a-4a are quite similar but it then becomes very different…arrow_forwardPrepare 5 liters of a 0.2 M dextrose solution using 5 liters of 5 M dextrose.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education