1/ Final [PNPP] (mM-1) 2.5 2 1.5 0.5 0 Km (mm) Vmax (μM/min) Lineweaver-Burk (LB) plot 1/ Final [PNPP] (mM-1) vs 1/VO (min/µM) y = 7.9966x -0.6983 Buffer 1 0.2 0.4 0.6 0.8 1/V0 (min/μM) y = 1.6343x -0.0839 Buffer 2 1 6. Determine the Km and Vmax from the LB plot for enzyme assays in buffer 1 and buffer 2. Buffer 1 Buffer 2 1.2 1.4
Q: Why would an old culture are more likely to form or have more endoscope than fresh ones?
A: Vegetative cells are the endospores that are produced by normal cells. Because the older culture has…
Q: 820 eid 10 e bas ela od tot esqytoney od obvo 3. A woman with type AB blood type gave birth to a…
A: ABO grouping is based on two antigens: Antigen A and Antigen B. Using plasma antibodies and the…
Q: Give an example of tree whose removal of leaves forms a noncaterpillar tree.
A: Phylum Arthropoda has several classes and “Insecta” is the largest class among all. Insects belong…
Q: talk about darwins journey in Falkland island, don't forget to talk about the tools that he used if…
A: Sir Charles Robert Darwin formulated the Theory of Evolution by Natural Selection, based on his…
Q: 마이다 어마어마 마이다이어리이다 ㅁㅇㅁㅇ ㅇㅇㅁㅁㅇㅁㅇㅁㅇㅁㅇ 1) The following pedigree shows a pattern of inheritance of a…
A: The answer is maternal imprinting; male parent
Q: 4. Terent. How does the difference between cellulose and glycogen affect their nutritional value to…
A: Complex carbohydrates must be broken down into simple monosaccharides that can be absorbed through…
Q: Q1.11. What is an ecological community? A group of individuals from a given species that interact A…
A: A subfield of research called ecology includes the fields of human science, demographic, population,…
Q: 2. A quantitative genetics determined the following variance components in a population of crabs…
A: The Formulas or equations for the calculation ofthe narrow sense heritability and Broad sense…
Q: Figure 14.23 shows a genetic switch that controls the choice between the lytic and lysogenic cycles…
A: The cellular activities are controlled by its internal habitat. The adaptation of cells to…
Q: irst image has info to answer second image question. Possible answers are A) The altered bacterium…
A: 1. Beta galactosidase will not be produced. If the promoter is placed in between lacZ and lac Y gene…
Q: Red-green color blindness is an X-linked recessive disorder. If Allison is heterozygous (a carrier),…
A: The X-linked genes show a different pattern of inheritance in males and females. The male progeny…
Q: Phospholipids are those lipids that make up the cell membranes of most living things. They are…
A: Phospholipids: Phospholipids are a subclass of lipids that have two hydrophobic "tails" made of…
Q: 1 Sarah, a trainee of the electron microscopist at the local hospital, is reviewing some…
A: mitochondria is an essential organelle of cell that general energy by phosphorylation in form of…
Q: Explain why it is common practice to also collect information about the physical environment when…
A: Disclaimer: - According to the BNED guidelines, only the first question can be answered unless…
Q: In the garden pea, yellow cotyledon color is dominant to green, and inflated pod shape is dominant…
A: x YC Yc yC yc YC YYCC Yellow inflated YYCc Yellow inflated YyCC Yellow inflated YyCc…
Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…
A: In the control of human metabolism, insulin is crucial. The -cells in the Islets of Langerhans…
Q: The so-called hypervariable regions (HV1 and HV2) of the human mitochondrial genome are sometimes…
A: HV1 and HV2 are two hypervariable regions found in the human mitochondrial DNA (deoxyribonucleic…
Q: Which female could be the mother of the child and why? Which male could be the father of the child…
A: There are several ways to identify the mother of a child from VNTR loci. One way is to look at the…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: Why should it make sense that a mitochondrion(a cellular organelle) is larger than a phospholipid…
A: Mitochondria (singular: mitochondrion) is the cell organelle that involves production of energy in…
Q: This diagram shows an animal cell in meiosis I during crossing over and synapsis. A single tetrad is…
A: Meiotic division includes Meiosis I and Meiosis II, which are necessary for the production of…
Q: give answer asap please.
A: The heart defects which occur in an individual from birth are called congenital heart defects. These…
Q: Which is the best possible hypothesis for explaining changes in cortical robusticity over time? a.…
A: The correct option is: The Increasing cortical robusticity associated with appearanceof morden…
Q: The evolution of multi-cellular body plan (first demonstrated by the Porifera) probably occurred…
A: Introduction:- Organisms can be multicellular or unicellular. Multicellular organisms are made up of…
Q: II. Questions for Research. 1. What are the adult derivatives of the pharyngeal pouches? 2. What is…
A: A research question is a question that a researcher asks in order to collect data that will help…
Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…
A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…
Q: expalin the therapeutic uses of atropine and mepyramine.
A: Atropine is an alkaloid,which is chiefly obtained from Atropa belladonna,It is a member of…
Q: estion 4 Dictyostelium discoideum is a slime mold used in research. In this species, individual…
A: Introduction : A species of soil-dwelling amoeba called Dictyostelium discoideum is a member of the…
Q: Which of the following is the concentration of hemoglobin-bound oxygen in the blood when the heme is…
A: Hemoglobin is a protein in the blood that carries oxygen. It is important because it helps to…
Q: 18. Which of the following has not been a major cause of the global population explosion that began…
A: Introduction POPULATION:- Population is the number of people in an area or a place. Therefore,…
Q: What are the formulating ingredients used in nicotine chewing gum? Please answer at your own easy…
A: Nicotine chewing gum is used for the cessation of smoking habit. It helps to decrease the withdrawal…
Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: Gaucher disease is caused by an accumulation of specific fatty compounds in organs, mainly spleen…
Q: A mutant haploid strain of Saccharomyces cerevisiae (yeast) called cox2-1 was found that was unable…
A: S. cerevisiae is utilized as a prototype in biological sciences to examine conserved processes…
Q: 1 4 H 11 Quadrat sampling is a method by which organisms in a certain proportion (sample) of the…
A: Quadrant sampling is the method which is used to count the number of organisms' population in a…
Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…
A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…
Q: What is the mechanism by which the Alu sequence has become dispersed to many sites in the genome?
A: An Alu elements is a transposable elements also known as the jumping gene . The transposable…
Q: All mutations in mitochondrial genes ultimately affect (whether directly or indirectly) the key…
A: Introduction: It goes without saying that the primary purpose of mitochondria is to produce ATP.…
Q: A male patient calls the office complaining of bloody urine accompanied by edema, headache, and…
A: Patients with contrast-induced nephropathy—defined as acute renal failure—present with an increased…
Q: I need a description about both branches of “external” and “internal” carotid artery and which…
A: The arteries that supply the blood to the brain, neck, and, head are called carotid arteries. These…
Q: Body shape varies systematically: according to altitude along latitudinal clines…
A: Introduction Evolutionary trends in shape type offer a vital context for deciphering variation among…
Q: Plant breeders have long appreciated the phenomenon called hybrid vigor or heterosis, in which…
A: Cytoplasmic male sterility (CMS) in corn is caused by defective mitochondrial genomes that impede…
Q: The liklihood that a Circulating Tumor Cell (CTC) will form a new metastatic colony is very low.…
A: Circulating tumour cells (CTCs) are cells that have detached from a primary tumour and are…
Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…
A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…
Q: Using the figure, compare the processes of mitosis and meiosis. Similarities…
A: Meiosis and mitosis are kinds of cell division processes that are seen in cells. Here the parent…
Q: Modern Homo sapiens are not the only species to use tools. Which other animals use tools? a. some…
A: Introduction: Tool use by animals is a phenomenon in which an animal uses any different kind of…
Q: How the Earth's atmosphere acts as a greenhouse (be specific)? Why is Earth's greenhouse effect…
A: The sun's light can reach Earth's surface thanks to greenhouse gases, which then trap the heat that…
Q: For that same genotype: In the presence of molecule A, what functional structural proteins are…
A: Introduction Gene is a functional unit of DNA. It carries all the information of a organism. Gene…
Q: What happens during the carbon fixation stage of the Calvin Cycle (light-indepedent reactions)?…
A: The Calvin cycle or light independent reactions follows three essential steps. These stages are…
Q: The figure illustrates the Sulphur cycle. True or false
A: Biogeochemical cycle is a cyclic pathway in which atoms or other elements are introduced, circulated…
Q: Q1.13. Early-successional plant species are characterized by life- history traits that do which of…
A: Ecology: A subfield of research called ecology includes the fields of human science, demographic,…
Step by step
Solved in 2 steps
- How much of 10,000x SYBR safe would you add to 50 ml to make a final concentration of 1x? V1= 0.005mL B.How will you set up the serial dilution? How many tubes do you need? What is the concentration in each? How much LB will you add to each tube? What volume of cells will you add?Calculate the volume of BSA stock that will be required to make the standard solutions needed to create the BSA standard curve. Be sure to show your work and include the volume of 0.02 M phosphate buffer required to reach a final volume of 1 mL. From a 2,000 μg/mL BSA stock, create 1 mL of each of the following stock solutions in 0.02 M phosphate buffer using individual microcentrifuge tubes: 50 μg/mL, 250 μg/mL, 500 μg/mL, 1,000 μg/mL, 1,250 μg/mL, 1,500 μg/mL. Be sure to properly label all the microcentrifuge tubes before creating the standards.Solution Absorbance mg/ml aspirin Standard solution - 1.6 mg/mL A 0.638 0.08 mg/mL B 0.504 0.064 mg/mL C 0.376 0.048 mg/mL D 0.259 0.032 mg/mL E 0.126 0.016 mg/mL A = -log T where T = %T ÷ 100 Construct a callibration curve using the above data. Absorbance should be on the vertical axis and "mg/mL of acetylsalicylic acid" on the horizontal axis. The line should go through the origin. Using the data provided, the graph you have generated, and the procedure that was used to generate the solutions which were examined by spectroscopy, calculate the amount of acetylsalicylic acid per tablet. Commercial tablet 1 labelled as 100 mg enteric coated Absorbance = 0.16 Commercial tablet 2 labelled as 300 mg Absorbance = 0.45 Student prepared tablet from practical 5 Absorbance = 0.19 Using the data provided, the graph you have generated, and the procedure that was used…
- Phenylephrine and nafazolin solutions are used as decongestants to relieve nasal congestion. Your patient has been given the following prescription below. You need to prepare 100 g of this nasal spray and make it isotonic. 1. There is an available 25% w/w Phenylephrine solution in the pharmacy. How many g of this solution will you need to supply the needed 0.5% of the patient? A. 1.0 g В. 1.5 g С. 2.0 g D. 4.0 g 2. Given the amount calculated on the previous item, and if the E value of phenylephrine HCl is 0.32, calculate its corresponding sodium chloride tonicic equivalent. А. 0.16 B. 0.64 С. 1.60 D. 6.40 3. If the E value of nafazolin is 0.27, what is the sodium chloride tonicic equivalent of the patient's needed nafazolin? A. 0.0135 B. 0.1350 1.3500 D. 13.500 4. What is the combined sodium chloride tonicic equivalent of the remaining ingredients (edetate disodium (E =0.24) and sodium metabisulfite (E = 0.7)? A. 1.060 B. 0.106 С. 1.290 D. 0.129 5. To make the solution isotonic, what…A flat (not spherical) tissue engineered skin (thickness 3.9 mm) is attached to the bottom of a dish and cultured with cell media atop it (which has an oxygen concentration of 0.15 mol/m3). The diffusivity of oxygen in the skin is 3.2 E-9 m?/s, and according to experiments that you've performed, you want to make sure that the concentration of oxygen in the device doesn't fall below 0.06 mol/m3. (Below that concentration harms the cells.) The rate of oxygen consumption is -5 E-17 mol/[cell•s]. What is the maximum cellularity (in cells/mL, three significant digits) that this tissue engineered skin can support?1.0 ml of serum albumin (BSA) solution was precisely diluted to 100 ml with a buffer solution, and the absorbance at 280 nm was measured from this buffer solution at a distance of 1 cm from the light. The result was A=1.0. BSA is 0.1%(=0.1g/l). The absorptivity is e(0.1%)=0.667, so 1g/l solution gives an absorbance of 0.667. What was the original protein content? Report in the result unit mg/ml with an accuracy of 0.1 mg.
- The calibration curve shown below was used to analyze an unknown protein solution. What is the concentration of the unknown solution, if the absorbance of the unknown is 0.505? Answer in ug/mL. 1.2 y%3D0.005x+0.061 R=0.992 0.8 0.6 0.4 0.2 50 100 150 200 250 Concentration ug/ml AbsorbanceAfter three minutes, the concentration of drug Zip in the red blood cells is 10 mmoles l-1. What is the average rate of entry of drug Zip into the red blood cells in units of moles min-1 red blood cell-1 during the first three minutes after placing the red blood cells into the bathing solution? Assume that each red blood cell occupies about 1 x 10-13 liters.You have been given a stock solution of dye that has a 10X concentration. You wish to make 750ul of a 1X dilution of this dye. Give the volume of 10X dye that you will use (in ul)
- BSA Concentration (ug/mL) Abs 2000 2.25 1500 1.715 1000 0.915 750 1.156 500 0.714 250 0.082 125 0.086 25 0.082 Create a BSA standard curve Abs562=f[BSA] using a Scatter Plot representation in Excel.The usual dose of digoxin for rapid digitalization is a total of 1.0mg, divide into two or more portion at intervals of 6 to 8 hours. How many milliliters of digoxin elixir containing 50mcg/mL would provide this dose?Figure 3: ● ● ● ● ● ● KDa ● 97.4 66.2 45.0 ● 31.0- 21.5 14.4 S-1 p-1 S-2 2-0 This figure was generated by centrifuging a pura sample of protein, removing the supernatant, and resuspending the pellet in the same volume as the supernatant to allow direct comparison. The supernatant and pellet samples were then prepared for SDS-PAGE identically and run via normal SDS-PAGE procedures. In the figure, "s" means supernatant and "p" means pellet. The text or number after the dash represents a different condition. For example, s-1 and p-1 are the supernatant and pellet samples under condition 1. It is not shown, but under wild-type conditions, essentially all of the protein is found in the supernatant. S-3 ● What does the intensity of each band represent? ● Would you find soluble protein in the supernatant or pellet? Why? Would you find aggregated protein in the supernatant or pellet? Why? For each condition (there are 5 different conditions), is there a higher percentage of the total protein…