A polyA tail makes the mRNA makes degrade more quickly.

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5-GATGTATA-3' Write the base…

A: Nucleic acids are the biomolecules that essential for the existence of life. They are the genetic…

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: After transcription, how is mRNA processed in eukaryotes?  (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: List what has to happen to pre-mRNA before it is considered mature mRNA

A: Pre-mRNA are formed when RNA transcript is firstly made in eukaryotic cells. This pre-mRNA has to be…

Q: This molecule makes up part of the structure that binds to an mRNA molecule to initiate…

A: Note: The process given in the question is assumed to be translation and not transcription.  DNA…

Q: pre-mRNA maturation to mRNA involves a guanosine nucleotide that is not part of the RNA polymer…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question.  Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: The residual end of a pre-mRNA transcript is digested by the following enzyme

A: Transcription is the process of formation of pre-mRNA (precursor mRNA) (heterogenous mRNA) from the…

Q: Small nuclear RNA from 50-200 bases that combine with proteins to form complexes capable of editing…

A: RNA editing is a post-transcriptional modification process that alters the sequence of RNA…

Q: Which of the following enzymes is NOT utilized in mRNA degradation? MARK ALL THAT APPLY Primase Poly…

A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: 5’-TAATTCTATGATATTAATATC -3’     mRNA sequence:     protein sequence:

A: The process of transcription of DNA to RNA and the RNA to protien  is based on complimantry DNA…

Q: What is the name of the process that adds multiple AMP residues to pre-MRNAS in eukaryotes? Capping…

A: Polyadenylation RNA splicing is a process which is found and eukaryotes but not in prokaryotes. It…

Q: In a gene, the start codon is generally_ while the stop codon is generally Select an answer and…

A: When it comes to genomics, translation refers to the process through which instructions included in…

Q: The 3' poly-A tail Otransports degrades protects the pre-mRNA molecule.

A: During mRNA processing the primary transcript known as pre-mRNA undergoes several modifications…

Q: ATG is the start codon for translating proteins into mRNA and nascent polypeptides are translated…

A:

Q: Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O…

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: During

A: Ans) During transcription, the coding strand is the same sequence as the newly synthesized mRNA…

Q: When production of a protein product from the mRNA is controlled by modifying the mRNA after it…

A: Post-transcriptional gene regulation is the regulation of a gene's expression at the RNA level; it…

Q: List 4 proteins involved in either Capping or tailing mRNA and tell whata each one does.

A: Answer: TRANSCRIPTION = It is the process of transcribing DNA in to mRNA , it is the second step of…

Q: You can adhere mRNA to a column using Oligo dT Introns Сар

A: DNA is the center of genetic sequences. The mRNA is formed by the DNA transcription when DNA…

Q: Several ribosomes attached to one mRNA,which they are all transcribing, form acluster called a/an

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It is passed on from one…

Q: If you want to decrease gene expression, you would need the activity of which RNA? O mRNA miRNA O…

A: RNA interference It is a mechanism that inhibits gene expression at the stage of translation or by…

Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…

A: Many processes occur within the cell for its normal functioning. They include replication,…

Q: what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR,…

A: Introduction A ribosome reads messenger ribonucleic acid (mRNA), a single-stranded RNA molecule that…

Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…

A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…

Q: Sequence of amino acids in protein

A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…

Q: during sicing,introns of pre-mRNAs go through an intermediate stage when they are shapedlike: a…

A: RNA is the intermediate molecule in the central dogma . They carry forward the information stored in…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: a codon on a strand of messenger RNA corresponds to a what

A: Messenger RNA is formed by a process called transcription in which a template strand of DNA is…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: The leader region of the trp mRNA is contains   A a short ORF   B a rho independent terminator   C…

A: The Correct Answer is option A. The leader region of the trp mRNA contains a short ORF. Tryptophan…

Q: If you have an mRNA sequnece below that looks like : 5' cap,  Cytidine, CCUCUUUUCC,  gene,  AAAAA…

A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…

Q: Splicing involves excision of introns excision of exons addition of exons addition of introns

A: An intron is a portion of a gene that does not code for amino acids.The parts of the gene sequence…

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: Nonsense mediated decay of an mRNA occurs when the mRNA forms a dsRNA. as soon as the ribosome…

A: In biology, messenger RNA (mRNA) is one of the types of single stranded RNA molecule that is formed…

Q: Introns are Poly A tail to RNA Noncoding sections of RNA Ribonucleoproteins Coding sections of RNA

A: Question: Introns are?

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.