please explain Bacillus cereus and its shape, arrangemnet, why indole test, starch hydrolysis test, and citrate utilization test were need to use to idetify the bactria?
Q: A black guinea pig is mated to a white guinea pig, and they produce 12 black offspring. Then, the…
A: A trait is a characteristic features that is unique to particular individual . As per the data :-…
Q: A 32-year-old woman who are suffering from thyrotoxicosis a biopsy of the thyroid gland has shown…
A: Introduction :- Hassall's corpuscles are composed of a structureless eosinophilic mass surrounded by…
Q: you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these…
A:
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A:
Q: Livestock Breed Identific - Student Notes 46. Piedmontese Size: breed Cows average between 1.200 to…
A: The Piedmontese is a breed of domestic cattle, originated in north west Italy in the region of…
Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…
A: The genetic material in majority of complex higher organisms and various viruses is DNA or…
Q: Are all foods created equal in terms of their effect on the environment? Explain.
A: The authors believe that items that are thought to be bad for your health, like red meat, are also…
Q: How does the immune response of the human body differ from a bacterial infection vs. an invasion of…
A: Immune system is composed of cells, organs and proteins. It protects our body from harmful…
Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…
A: The answer is 1.17 mL of cells and 3.83 mL of medium
Q: What do you mean by protandry? Give its advantages?
A: The term protandry comes from two Latin terms, Proto= First and andro= male (thus, anthers in case…
Q: The main difference between starch and cellulose is: O A) starch is made of fructose, while…
A: Starch Cellulose Uses about 200-1000 Glucose molecules to form one starch molecule. Take up 500…
Q: Which example below is a positive feedback relevant to Earth’s global energy balance? a. Increased…
A: Introduction :- Positive feedback is a feedback loop in which the outcomes of an action cause more…
Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…
A: The answer is 1.17 mL of cells and 3.83 mL of medium
Q: Briefly exaplain bacterial genetics and the operon organization of genes concept.
A: Bacterial genetics is the study of heritable information systems in bacteria, including their…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Adenine, guanine, cytosine and thymine are the nucleotide bases of DNA that stores genetic…
Q: 15. Why is PK > PNa and by about how much?
A: After discovery of electricity, scientists discovered that conduction from brain to muscle was…
Q: As tubular filtrate flows down the descending limb of the loop of Henle, it becomes: O hypoosmotic O…
A: Water gradually diffuses out from the descending Henle loop. The solvents in the filtrate are…
Q: QUESTION 28 The flies in the figure are mated. Which chromosomes would have the highest frequency in…
A: A breeding experiment among two animals that are exactly hybrid for two features is referred to as a…
Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…
A: Passive tissue is those that undergo stretching when they are not even stimulated and hence…
Q: What happens if you ingest too much triacylglycerol?
A: Triglycerides are a type of fat (lipid) found in your blood. When you eat, your body converts any…
Q: Which of the following applies to quaternary structure? O a. It has two alpha and two beta subunits…
A: Proteins structures are made by condensation of amino acids forming peptide bonds. Classification…
Q: What do coral cores show us??
A: Introduction Corals are marine invertebrates that belong to the phylum Cnidaria's class Anthozoa.…
Q: Why is Endo Agar is recommended for membrane filtration experiment and not TSA plate?
A: Membrane filtration is a water sample testing technique. Water is drawn through a specific porous…
Q: 8. If you only had the amino acid sequence of the protein, would you be able to figure out the exact…
A: Translation Through the process of translation, mRNA sequences is translated into the sequence of…
Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…
A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…
Q: Drag and drop the correct term to the diagram beloW. Drop Area Drop Area Drop Area Drop Area
A: Chloroplasts are a form of plastid, which is a circular, oval, or disk-shaped entity engaged in food…
Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…
A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…
Q: Which of the following cells secretes the enzymes - gastric lipase and pepsin ogen? Group of answer…
A: Mucous neck cells: These basically located in gastric glands. These contain less mucin in apical…
Q: In ecological systems, a rough rule of thumb is that when energyis transferred from plants to…
A: Energy transfer from one organism to another organism in an ecosystem occurs through the food chain.…
Q: racteristics mparison of Major Taxa Fungi Bacteria Archaeans Protists Plants Animals None of the…
A: The given diagram shows the different characteristics of taxonomical classification of different…
Q: Describe some characteristics and differences between prokaryotic and eukaryotic cells.
A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…
Q: D Question 19 What is the name of the enzyme responsible for removal of one glucosyl unit from the…
A: The enzyme which removes one glucosyl unit from non reducing end if glycogen is glycogen…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…
A: Mutation is a permanent variation of some nucleotide sequences in an organism's genome that can…
Q: Select the option that is a scientific hypothesis and is testable and false able?(Choose all that…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: Geological Time Scale Range Chart Million Era Period Years ago Notable events Historic time…
A: Geological time scale: In simple words we can call the geological time scale the calendar for the…
Q: Would you expect more or less similarity between embryos from distantly related species? Explain and…
A: In evolution, embryology is one type of study which deals with embryos. An embryo is an unborn (or…
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A: The answer is option D.8.7×10 power 6.
Q: Allele Frequency Allele Frequency 18 Allele Frequency Locus Locus Locus 0.015 19 VWA 12 0.015 FGA…
A: I will gave you the answers below. As per our guideline i will answer fast 3 subpart. Rest of the…
Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines
A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…
Q: What is the most probable cause of the patient’s elevated urea nitrogen?
A: The patient has the conditions of chronic renal failure, diabetes, heart failure, anaemia, HTN. The…
Q: whether they are hypotonic or hypertonic, does it have a correlation to why they are bony or…
A: For better understanding, let's understand by knowing the terms used in the question. Hypertonic…
Q: Please respond to 1-5
A: 1. relating to a person's awareness of the position and movement of the parts of the body by means…
Q: Below is a Figure from a Shoot Tip, determine which labeled part is/are meristematic? 2
A: Apical meristem Region of cells capable of division and growth in the root and shoot tips in plants.…
Q: malaria
A: Malaria : Malaria is an infection caused by a few plasmodium species which are single celled…
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A:
Q: Section E. The Secondary Tissues of Roots in Woody Dicots Identify and label these parts in old…
A: Roots that are still growing are called young roots. The phellem, the periderm's outermost layer, is…
Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…
A: ANSWER;- A) cadherin- desmosomes B) cellulose - cell wall C) collagen - basal lamina D) connexons -…
Q: Which of the following is false? a. Stems have vascular bundles, and roots have vascular cylinders.…
A: Botany, often known as plant science, plant biology, or phytology, is a discipline of biology that…
Q: the yeast isolates are Cryptococcus neoformans and Candida albicans. what test will you do yo…
A: Fungus Fungus is a saprophytic, spore-forming organism that belongs to the domain Eukaryota. These…
please explain Bacillus cereus and its shape, arrangemnet, why indole test, starch hydrolysis test, and citrate utilization test were need to use to idetify the bactria? |
Step by step
Solved in 2 steps
- What is this organism? And what other test could be done to confirm it's identification? 1.Gram stain - positive cocci, chains Catalase - weak positive Hemolysis - beta BE - positive NaCl- positive Bacitracin - no zone of inhibition PYR - positive Answer: Enterococcus spp. CAMP test to verify the identity 2.Gram positive cocci, chains Catalase - negative Hemolysis - alpha BE - negative NaCl - negative P disk - resistant Bile Solubility - negative Answer - viridans group, Use PYR test to verifyIs phenol red test a efficient test for unknown intestinal bacteria?Is tripple sugar iron test a efficient test for unknown intestinal bacteria?
- Which of the following tests can be used to distinguish between group D streptococcus and other streptococcus bacteria? Mannitol Salt agar Coagulase test McConkey agar Bile eschulin agar Simmon's Citrate agarGiven: Enterobacteriaceae, Vibrionaceae, Pasteurellaceae and other organisms such as Calymmatobacterium, Cardiobacterium, Chromobacterium, Eikenella, Gardnerella, Streptobacillusand Zymomonas Test Unknown Isolate B 1 Luminescence Positive 2 Cell Shape Straight Rods 3 Gram Staining Negative 4 Oxygen Requirement Facultative Anaerobe 5 Motility (Hanging Drop) Motile 6 Growth at 0% NaCl Negative 7 3% NaCl Positive 8 6 % NaCl Positive Attached is the sampleSolve the identity of an unknown bacterial specimen by creating a dichotomous key. Categories: Gram stain, Mannitol salt agar,MacConkey agar, Catalase, Oxidase, Casein hydrolysis, Nitrate reduction, Citrate test, Urease test, Sim Medium Streptoccocus ID: 1) Bile Esculin Test 2) Bacitracin Test 3) Blood Agar Plate NaCl Broth Staphylococcus ID: 1) Mannitol Salt Agar 2) DNA Hydrolysis 3) Coagulase Test 4) Novobiocin Test Possible Organisms Alcaligenes faecalis Enterobacter aerogenes Enterococcus faecalis Escherichia coli Proteus vulgaris Pseudomonas aeruginosa Salmonella arizoniae Staphylococcus aureus Staphylococcus epidermidis Staphylococcus saprophyticus Streptococcusbovis Streptococcus pyogenes
- Explain how PEMBA (polymyxin-pyruvate-egg yolk-mannitol-bromthymol blue-agar) is used to isolate, differentiate and enumerate Bacillus cereus from food sample.Selective and Differential Conditions of media and culture conditions can be used to culture and identify Listeria monocytogenes. For each, characterize it as Available Hint(s) Res Adding antibiotics, such as nalidixic acid Adding high concentrations of salts, such as lithium chloride and sodium chloride Adding a pH indicator to detect fermentation of hamnose to acid Incubate at 30°C Detecting beta-hemolysis Adding antifungals, such as amphotericin B Differential Selectivediscuss the clinical significance, principles, reagents (if any) and positive and negative results of the following laboratory tests for Gram positive cocci organisms: Bile esculin test 5% salt turbidity or tolerance test PYRase test Pyruvate broth test
- Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgarisIs Endospores stain test a efficient test for unknown intestinal bacteria?I AM TRYING TO IDENTIFY THIS UNKNOWN. IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. I believe it is one of the following: 1) S. pyo. 2)S. agal . 3)S.pneu. 4)E. faecalis 5)S. aureus 6)S epi. 7)S. sapro. 8)M. luteus Please let me know which test will i need out of the table to justify your reason of picking up the unknown and also how that test justifies it? what characteristics of that test made you pick the unknown?