PCR is a way for scientists to amplify DNA using primers and a special heat resistant polymerase. With a little ingenuity this process has been used to read the DNA sequence. With that in mind. With the help of Reverse Transcriptase, what other kinds of genetic material can we sequence? (hint this is important in identifying Covid

PCR is a way for scientists to amplify DNA using primers and a special heat resistant polymerase. With a little ingenuity this process has been used to read the DNA sequence. With that in mind. With the help of Reverse Transcriptase, what other kinds of genetic material can we sequence? (hint this is important in identifying Covid

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Similar questions

Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Discuss the following statement: “primase is a sloppy enzyme that makes many mistakes. eventually, the rna primers it makes are disposed of and replaced with dna synthesized by a polymerase with higher fidelity. this is wasteful. it would be more energy-efficient if a dna polymerase made an accurate copy in the first place.”
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction. This technique detects the fluorescence produced by reporter molecules like SYBR® Green dye or TaqMan® probe during the DNA amplification reaction. Compare and contrast between SYBR® Green and TaqMan® probe with illustrations.
To amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomes
PCR is quick, efficient and easy to perform. However, there are some situations when cell-based cloning is preferred over PCR to amplify a DNA sequence. Mention two of them.
The polymerase chain reaction can only be used to amplify genes that have been cloned and sequenced. Why is this true?
The idea behind PCR-based diagnostics is that a very small number of microbial genomes in a patient sample can be multiplied by PCR and more easily detected by the clinical team managing the patient’s care. Also, genetic-based diagnostics are very useful for viral infections because we don’t have biochemical tests, etc. to distinguish one virus from another (remember, viruses are metabolically inactive). However, a lot of work goes into the development of these tests. For instance, PCR requires primers that are complementary to the viral genome that is being copied. If primers are complementary to the target genome, what must scientists know to design primers that bind to the viral genome to be copied? (I mean this to be a general question; don’t look up the details of designing primers)
Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed facilitated research in various areas of molecular biology and genetics. Why is the annealing temperature vital in this technique? Explain how annealing temperature will affect the efficiency of this reaction.
Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not? How many more genes in the plasmid (besides the insulin cDNA insert) are need to determine which bacterial cells have been transformed and to determine which transformed bacterial cells have a plasmid with the cDNA insulin insert? What is needed in the plasmid with the cDNA insert besides the gene for insulin to actually cause the bacteria to express the insulin gene and produce the insulin protein?
A number of advances have been made in biotechnology. CRISPR/Cas9 one of the most controversial, and has had a lot of media attention in recent years. It is a method by which scientists can precisely edit DNA sequences at exact locations. Benefits obviously include the potential to “repair” mutated genes that cause disease. In fact, preliminary results from one of the earliest clinical trials of CRISPR/Cas9 provide evidence that the technique is safe and feasible to use for treating human diseases. What other potential applications of this application do you see (you can use any organisms to illustrate your answer)? What are the potential dangers or downsides of using this technology? Do you think this technology should be used in gene editing in humans? Explain your stance.
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?