(p) | || (q) rrrrrr || || (b) hun h || =

Q: please solve this with step-by-step calculations and explanations.

A: The following is a step-by-step solution to this problem:a. In order to determine the melting…

Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…

A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…

Q: Watch the following video called "Human Genome Project Video"…

A: Decoding the human genome has provided a wealth of information that is revolutionizing medicine,…

Q: How is the color of the spot coverted into useful data if data is collected from a Vicrochip DNA…

A: DNA microarray is a chip-based technique where a collection of microscopic DNA spots attached to a…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: What is a clue cell?

A: CLUE CELL:            The epithelial cells that originates in vagina with a stippled appearance due…

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the…

A: Pyrosequencing is a next-generation technique of DNA sequencing. This method can be used to detect…

Q: A geneticist is interested in determining the locations of methylated cytosines within a fragment of…

A: A geneticist is a person who analyze the genomic profiling expression and the pedigree analysis of a…

Q: You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown…

A: A primer is a brief sequence of single-stranded DNA that is utilized in the PCR method of polymerase…

Q: Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the…

A: DNA stands for deoxyribonucleic acid and it consists of 4 types of nitrogen bases, adenine, guanine,…

Q: Based from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality…

A: Agarose Gel electrphoresis is done to segregate the DNA bands according to its size. The size can be…

Q: List essential components required for the DNA sequencing reaction based on the Sanger method.…

A: DNA sequencing is the process of determining the sequence of nucleotides  in a piece of DNA. In…

Q: (Practice Hint: Click on the right-hand column to choose a bar height. Click again to change the bar…

A: DNA is made up of four nitrogenous bases: adenine (A), thymine (T), guanine (G), and cytosine (C).…

Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today?…

A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA…

Q: What was the function of each solution or step in the DNA purification protocol? The following…

A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…

Q: After properly troubleshooting, you finally are able to visualize the gel. You obtained the image…

A: DNA extraction is a protocol of isolating genomic DNA from any cell type. Generally we use the…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…

A: In PCR, forward and reverse primers are to  be added. PCR involves denaturation, annealing and…

Q: What does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: Chironomus genomic DNA contains approximately 35.5% A. Estimate the percentages of G, C, and T in…

A: The double (ds) stranded DNA duplex structure follows the chargaffs rule, which suggests that the A…

Q: Consider the following image of a stained agarose gel representing the separation of a plece of DNA…

A: Gel electrophoresis is a biochemical technique in which macromolecules such as DNA  can be separated…

Q: You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in…

A: DNA sequencing is an important technique used to determine the sequence of unknown fragments of DNA…

Q: For what purposes is DNA extraction done? (give at least 3 purposes for which you may need to…

A: A technique that is used to isolate DNA from a biological sample is referred to as DNA extraction.…

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single…

A: A population is said to be in Hardy Weinberg equilibrium if it satisfies 2 equations; p+q+r=1 and…

Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…

A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how…

A: The answer to the first question is, 3 grams of agarose in 150 ml of TBE.   *to get the second…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: The SNP is single-nucleotide polymorphism is a variation of DNA sequence that occurs when single…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: A piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece…

A: Restriction enzyme is any enzyme that cleaves DNA at a particular sequence. Example - BamHI, EcoRI,…

Q: What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis…

A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…

Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…

A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: Can you please interpret and discuss and mark, this gel electrophoresis results.  DNA ladder sizes:…

A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are…

Q: Our PCR samples already contain loading dye, but sometimes this isn’t the case. If your samples…

A: Gel electrophoresis is a process that helps in the separation of DNA fragments based on sizes with…

Q: Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table…

A: Global Alignment: It is a bioinformatics algorithm used to align protein or nucleotide sequences. A…

Q: You have run a gel with 5 uL of amplified DNA in addition to 1 uL of 6X loading dye. Comparing the…

A: Agarose Gel Electrophoresis (AGE), is an biochemistry technique which is used to estimate DNA…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using…

A: In Str analysis, if the gene has homozygous alleles then there would be only one peak shown in the…

Q: Labelled primers or dNTPs are useful in some recombinant DNA techniques. What are DNA primers? What…

A: 1* DNA primers is a short and single stranded nucleic acid sequence that is the starting point for…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…

Q: Why RT-PCR is important in the sample preparation to perform expression microarray experiment?

A: RT - PCR : Reverse transcription- polymerase chain reaction is one of the types of PCR.  DNA…

Q: To be able to properly analyze a sample of DNA, you need to have at least 1 µg of the DNA of…

A: The polymerase chain reaction (PCR) is a molecular biology technique for amplifying particular…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.