Answered: In the "Indexing DNA" method of n k-mer…

Name: In the "Indexing DNA" method of n k-mer table, the maximum number ofc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In the "Indexing DNA" method of n k-mer table, the maximum number ofcompares when the k-mers are sorted isSelect one:O 1. log2(n)O 2. nlogn3. nO 4. None of above

Science

Biology

In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is Select one: O 1. log2(n) O 2. nlogn O 3. n 4. None of above

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

A sample of DNA with the sequence 5'- CTC GAG CGA AGC TCA ACC-3' he was obtained as a dry solid. The sample was dissolved in 1000 µl of deionized water ane mixed well. Ten microliters of the dissolved sample was then transferred to a new sampie tube and mixed with 990 ul of water, The dilute sample had A260 = 0.156. What was the concentration of the original sample (the solid dissolved in 1000 ul of deionized water)
Permutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?
Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
The genetic distance between DNA sequences 1 and 2 is what value? 1 T C G A C A C c G G A T T 2 А т с с А с с с о с G А Т 4 O 5
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
The photograph provided is of a 1 μg of 2-log ladder indicating the molecular size in kilobases (Kb) and amount of DNA per band in ng. Estimate the concentration of your PCR product (amplicon) in ng/μL by visual comparison. The expected size of your amplicon is about 600-bp (0.6 kb). ____μg/μL?
Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…
Please answer You have received a dehydrated sample of DNA primer at a concentration of 19.9 microM. what volume (in microlitres) of buffer would you add to achieve a solution of 100nM of this primer? Show workings.