Concept explainers
The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label. A sample of the DNA was reacted with DNA polymerase and each of the
in relatively small amounts.
1. dATP, dTTP, dCTP, dGTP, ddTTP
2. dATP, dTTP, dCTP, dGTP, ddGTP
3. dATP, dCTP, dGTP, ddTTP
4. dATP, dTTP, dCTP, dGTP
The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like?
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
- Suppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw a diagram of the expected gel to show the location of the cut DNA pieces. arrow_forwardConsider the following: Restriction enzymes bind and cut between bases T and A. Based on this, which of the following are not acceptable VNTR segments? The DNA segment under consideration is AGTTAC GTTACA TCAATG CAATGTarrow_forwardThe nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’ a. 5’ – CGAUACGC – 3’ b. 5’ – CGATACGC – 3’ c. 5’ – CGAGCUGC – 3’ d. 5’ – CGAGCTGC – 3’ e. None of the abovearrow_forward
- Please don't provide handwriting solutionarrow_forwardWhat is the purpose of using the Chelex beads while extracting the DNA at high temperature from your cheek cells? Group of answer choices The Chelex binds cations like Mg2+ that are co-factors for nuclease enzymes which would otherwise degrade the DNA. The Chelex denatures the DNA and makes the DNA single stranded. The Chelex will bind the DNA tightly after the cells are ruptured, helping extract it from the cells. The Chelex provides Mg2+ co-factors needed by DNA polymerase enzymes to make more copies of DNAarrow_forwardWhich of the following chemicals or procedures is not involved in a typical Polymerase Chain Reaction (PCR). Select one: O a. ddNTPs b. O C. O d. Oe. O f. Repeated cycling (typically 32 cycles) for exponential target amplification DNA strand replication/extension Annealing of oligonucleotide primer or primers Thermostable (Taq) DNA polymerase Buffer with required cofactor: Mg 2+ Og. DNA template Oh. High temperature denaturation O i. dNTPsarrow_forward
- In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp, 700 bp, 500 bp, 200 bp, and 100 bp. When the gel was run and stained, the following photograph of the gel was taken. Click directly on the band in lane 1 that represents the DNA fragment that is 500 bp in size.arrow_forwardDNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA fluoresces when illuminated with UV light the binding of a fluorescent dye that is easily detectable using radioactive antibodies that specifically bind to DNA the fact that DNA is blue and can be seen when millions of copies are present in a bandarrow_forwardPlease write down the DNA sequence inferred from the below DNA gel. Shown are the products of a dideoxy sequencing reaction.arrow_forward
- please solve this with step-by-step calculations and explanations.arrow_forwardThe following question is related to Restriction Enzymes and RFLP. Using EcoRl, the smallest fragments between DNA sequence A and B were how many base pairs?arrow_forwardUse the plasmid to answer the following questions a) Digest the plasmid with EcoRI only and then both EcoRI and BamHi together. Fill in the table to show the fragment sizes produced.arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON