What would be the final primer concentration if 0.5 ul of 10 uM primers were ad a PCR reaction with a final volume of 20 ul? O 0.25 uM O 20 uM 0.2 uM OS uM 1 M

Draw your own PCR diagram to show the role of each component and relevance of each temperature shift during the PCR reaction. What’s happening at each of those temperatures and why is it important it changes?

The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression.  What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert

Using the designed forward and reverse primer from Question 23-30, you performed PCR to amplify the CO1 gene of S. tawilis. Then, you verified the PCR product using the Agarose Gel Electrophoresis. Here is the result of the AGE. M-Marker L1-PCR Product ML1 You noticed that there are many bands in your PCR product. What does this indicate? Choose the best answer. The primers were not specific to CO1 gene. The annealing temperature is too high. The templated DNA is not enough. There is a formation of primer dimers. The primer length is too short. The melting temperature is too high.

please solve this with step-by-step calculations and explanations.

All things considered, the most important factor with respect to successful PCR is Multiple Choice primer design annealing temperature extension time quantity of template

What are the reasons why there needs to be more than 10 cycles in the PCR process? Name 2 reasons.

What are the components require in a PCR reaction?  And justify them?  Please answer at your own words.

After plasmid isolation, you take 0.5 uL of the sample and mix it with 1 uL of TE buffer. The absorbance of this sample at 260 nm is 0.8 and the average extinction coefficient of double-stranded DNA at 260 nm is 0.020 (μg/ml)−1 cm−1. What is the concentration of the undiluted sample?     120 μg/mL     80 μg/mL     40 μg/mL     12 μg/mL

You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts. Assuming a random distribution of these bases what is the expected distance (ie there will be a cut once in every XX base pairs) between cut-sites for restriction enzyme that cuts at the sequence GAATTC? 256 3207 4168 4096